Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNF149 Gene

Aliases for RNF149 Gene

  • Ring Finger Protein 149 2 3 5
  • RING-Type E3 Ubiquitin Transferase RNF149 3 4
  • DNA Polymerase-Transactivated Protein 2 3 4
  • DNAPTP2 3 4
  • E3 Ubiquitin-Protein Ligase RNF149 3
  • RING Finger Protein 149 4
  • EC 2.3.2.27 4

External Ids for RNF149 Gene

Previous GeneCards Identifiers for RNF149 Gene

  • GC02M101513
  • GC02M101351
  • GC02M101258
  • GC02M101887
  • GC02M095656

Summaries for RNF149 Gene

GeneCards Summary for RNF149 Gene

RNF149 (Ring Finger Protein 149) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include ligase activity and ubiquitin-protein transferase activity. An important paralog of this gene is RNF150.

UniProtKB/Swiss-Prot for RNF149 Gene

  • E3 ubiquitin-protein ligase. Ubiquitinates BRAF, inducing its proteasomal degradation.

Additional gene information for RNF149 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNF149 Gene

Genomics for RNF149 Gene

GeneHancer (GH) Regulatory Elements for RNF149 Gene

Promoters and enhancers for RNF149 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J101305 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 681.7 +0.1 77 7.2 HDGF SMAD1 FOXA2 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 IRF4 RNF149 MIR5696 LOC105373512 SNORD89 IL1R1 MAP4K4 RPL31 GC02M101274
GH02J101250 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 27.8 +55.7 55691 4.1 HDGF PKNOX1 FOXA2 ZFP64 ARID4B SIN3A DMAP1 YY1 SLC30A9 POLR2B TBC1D8 CNOT11 SNORD89 RNF149 LOC105373511
GH02J101327 Enhancer 1.4 FANTOM5 Ensembl ENCODE 31.2 -20.8 -20758 4.2 PKNOX1 ATF1 CLOCK MLX ARID4B NEUROD1 DMAP1 ZNF48 YY1 ZNF207 RNF149 CREG2 SNORD89 MAP4K4 MIR5696 ENSG00000226058
GH02J101712 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 24.7 -409.9 -409919 11.9 ZFP64 EBF1 BATF GATA3 ZNF316 POLR2A EGR1 EED ETV6 IKZF2 IL1R2 RNF149 MAP4K4 IL1R1 GC02M101710 GC02P101903
GH02J101245 Enhancer 1 ENCODE dbSUPER 25.3 +62.7 62655 1.6 DRAP1 SAP130 ARID4B KAT7 ERF DMAP1 ZNF644 KDM3A ZNF48 RARA RNF149 SNORD89 CNOT11 TBC1D8 TBC1D8-AS1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RNF149 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the RNF149 gene promoter:
  • Cart-1
  • RFX1
  • HEN1
  • CP2
  • HTF
  • AP-4
  • POU2F1
  • POU2F1a
  • POU3F2
  • LCR-F1

Genomic Locations for RNF149 Gene

Genomic Locations for RNF149 Gene
chr2:101,271,219-101,308,716
(GRCh38/hg38)
Size:
37,498 bases
Orientation:
Minus strand
chr2:101,887,681-101,925,178
(GRCh37/hg19)
Size:
37,498 bases
Orientation:
Minus strand

Genomic View for RNF149 Gene

Genes around RNF149 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNF149 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNF149 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNF149 Gene

Proteins for RNF149 Gene

  • Protein details for RNF149 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8NC42-RN149_HUMAN
    Recommended name:
    E3 ubiquitin-protein ligase RNF149
    Protein Accession:
    Q8NC42
    Secondary Accessions:
    • Q53S14
    • Q8N5I8
    • Q8NBY5
    • Q8WUU3

    Protein attributes for RNF149 Gene

    Size:
    400 amino acids
    Molecular mass:
    43165 Da
    Quaternary structure:
    No Data Available

neXtProt entry for RNF149 Gene

Post-translational modifications for RNF149 Gene

  • Ubiquitination at posLast=260260 and posLast=245245
  • Glycosylation at Asn145 and Asn52
  • Modification sites at PhosphoSitePlus

Other Protein References for RNF149 Gene

No data available for DME Specific Peptides for RNF149 Gene

Domains & Families for RNF149 Gene

Gene Families for RNF149 Gene

HGNC:
Human Protein Atlas (HPA):
  • Enzymes
  • Predicted membrane proteins

Protein Domains for RNF149 Gene

Suggested Antigen Peptide Sequences for RNF149 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q8NC42

UniProtKB/Swiss-Prot:

RN149_HUMAN :
  • The RING-type zinc finger domain mediates binding to an E2 ubiquitin-conjugating enzyme.
Domain:
  • The RING-type zinc finger domain mediates binding to an E2 ubiquitin-conjugating enzyme.
genes like me logo Genes that share domains with RNF149: view

Function for RNF149 Gene

Molecular function for RNF149 Gene

UniProtKB/Swiss-Prot Function:
E3 ubiquitin-protein ligase. Ubiquitinates BRAF, inducing its proteasomal degradation.
UniProtKB/Swiss-Prot CatalyticActivity:
S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.

Enzyme Numbers (IUBMB) for RNF149 Gene

Phenotypes From GWAS Catalog for RNF149 Gene

Gene Ontology (GO) - Molecular Function for RNF149 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016740 transferase activity IEA --
GO:0046872 metal ion binding IEA --
GO:0061630 ubiquitin protein ligase activity IEA --
genes like me logo Genes that share ontologies with RNF149: view
genes like me logo Genes that share phenotypes with RNF149: view

Animal Model Products

  • Taconic Biosciences Mouse Models for RNF149

CRISPR Products

miRNA for RNF149 Gene

miRTarBase miRNAs that target RNF149

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RNF149

Clone Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for RNF149 Gene

Localization for RNF149 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RNF149 Gene

Membrane; Single-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RNF149 gene
Compartment Confidence
extracellular 5
plasma membrane 3
mitochondrion 1
endoplasmic reticulum 1
golgi apparatus 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Plasma membrane (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for RNF149 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane HDA 19946888
GO:0016021 integral component of membrane IEA --
GO:0070062 extracellular exosome HDA --
genes like me logo Genes that share ontologies with RNF149: view

Pathways & Interactions for RNF149 Gene

SuperPathways for RNF149 Gene

No Data Available

UniProtKB/Swiss-Prot Q8NC42-RN149_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

Gene Ontology (GO) - Biological Process for RNF149 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016567 protein ubiquitination IEA --
GO:0031647 regulation of protein stability IEA --
GO:0035690 cellular response to drug IEA --
GO:0043409 negative regulation of MAPK cascade IEA --
genes like me logo Genes that share ontologies with RNF149: view

No data available for Pathways by source and SIGNOR curated interactions for RNF149 Gene

Drugs & Compounds for RNF149 Gene

No Compound Related Data Available

Transcripts for RNF149 Gene

Unigene Clusters for RNF149 Gene

Ring finger protein 149:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RNF149

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for RNF149 Gene

No ASD Table

Relevant External Links for RNF149 Gene

GeneLoc Exon Structure for
RNF149
ECgene alternative splicing isoforms for
RNF149

Expression for RNF149 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RNF149 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for RNF149 Gene

This gene is overexpressed in Whole Blood (x17.6).

Protein differential expression in normal tissues from HIPED for RNF149 Gene

This gene is overexpressed in Neutrophil (44.3) and Monocytes (17.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for RNF149 Gene



Protein tissue co-expression partners for RNF149 Gene

NURSA nuclear receptor signaling pathways regulating expression of RNF149 Gene:

RNF149

SOURCE GeneReport for Unigene cluster for RNF149 Gene:

Hs.142074

Evidence on tissue expression from TISSUES for RNF149 Gene

  • Nervous system(4.5)
genes like me logo Genes that share expression patterns with RNF149: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNF149 Gene

Orthologs for RNF149 Gene

This gene was present in the common ancestor of animals.

Orthologs for RNF149 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia RNF149 34 33
  • 99.25 (n)
OneToOne
dog
(Canis familiaris)
Mammalia RNF149 34
  • 85 (a)
OneToOne
cow
(Bos Taurus)
Mammalia RNF149 34 33
  • 84.31 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Rnf149 33
  • 81.55 (n)
mouse
(Mus musculus)
Mammalia Rnf149 16 34 33
  • 81.04 (n)
oppossum
(Monodelphis domestica)
Mammalia RNF149 34
  • 71 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia RNF149 34
  • 69 (a)
OneToOne
chicken
(Gallus gallus)
Aves RNF149 34 33
  • 76 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia RNF149 34
  • 61 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia rnf149 33
  • 66.39 (n)
worm
(Caenorhabditis elegans)
Secernentea H10E21.5 34
  • 21 (a)
OneToMany
Species where no ortholog for RNF149 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for RNF149 Gene

ENSEMBL:
Gene Tree for RNF149 (if available)
TreeFam:
Gene Tree for RNF149 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for RNF149: view image

Paralogs for RNF149 Gene

(7) SIMAP similar genes for RNF149 Gene using alignment to 2 proteins:

  • RN149_HUMAN
  • F8WCD0_HUMAN
genes like me logo Genes that share paralogs with RNF149: view

Variants for RNF149 Gene

Sequence variations from dbSNP and Humsavar for RNF149 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs763258401 A breast cancer sample 101,308,570(-) C/A/T coding_sequence_variant, genic_upstream_transcript_variant, missense_variant, non_coding_transcript_variant, stop_gained, upstream_transcript_variant
rs1000017454 -- 101,287,388(-) T/C genic_downstream_transcript_variant, intron_variant
rs1000051823 -- 101,303,370(-) A/C intron_variant
rs1000112217 -- 101,286,002(-) TGTTTCTAGTCAATAATGAAACTGAAT/T genic_downstream_transcript_variant, intron_variant
rs1000146863 -- 101,294,170(-) G/A intron_variant

Structural Variations from Database of Genomic Variants (DGV) for RNF149 Gene

Variant ID Type Subtype PubMed ID
nsv961845 CNV duplication 23825009
esv3892993 CNV gain 25118596
esv3591764 CNV loss 21293372
esv34123 CNV loss 18971310

Variation tolerance for RNF149 Gene

Residual Variation Intolerance Score: 68.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.85; 83.61% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for RNF149 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RNF149

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RNF149 Gene

Disorders for RNF149 Gene

Additional Disease Information for RNF149

No disorders were found for RNF149 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RNF149 Gene

Publications for RNF149 Gene

  1. Ring finger protein 149 is an E3 ubiquitin ligase active on wild-type v-Raf murine sarcoma viral oncogene homolog B1 (BRAF). (PMID: 22628551) Hong SW … Kim TW (The Journal of biological chemistry 2012) 3 4 58
  2. Genome-wide association study of pancreatic cancer in Japanese population. (PMID: 20686608) Low SK … Sakamoto H (PloS one 2010) 3 44 58
  3. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for RNF149 Gene

Sources for RNF149 Gene

Content
Loading form....