This gene was initially identified as a transcriptional repressor that represses neuronal genes in non-neuronal tissues. However, depending on the cellular context, this gene can act as either an oncogene or a tumor suppressor. The encoded protein is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence elemen... See more...

Aliases for REST Gene

Aliases for REST Gene

  • RE1 Silencing Transcription Factor 2 3 5
  • RE1-Silencing Transcription Factor 2 3 4
  • Neural-Restrictive Silencer Factor 3 4
  • NRSF 3 4
  • XBR 3 4
  • Neuron Restrictive Silencer Factor 3
  • Neuron-Restrictive Silencer Factor 2
  • Repressor Binding To The X2 Box 3
  • Deafness, Autosomal Dominant 27 2
  • X2 Box Repressor 4
  • GINGF5 3
  • DFNA27 3
  • HGF5 3
  • WT6 3

External Ids for REST Gene

Previous HGNC Symbols for REST Gene

  • DFNA27

Previous GeneCards Identifiers for REST Gene

  • GC04P057577
  • GC04P057730
  • GC04P057689
  • GC04P057614
  • GC04P057468
  • GC04P053727
  • GC04P057774

Summaries for REST Gene

Entrez Gene Summary for REST Gene

  • This gene was initially identified as a transcriptional repressor that represses neuronal genes in non-neuronal tissues. However, depending on the cellular context, this gene can act as either an oncogene or a tumor suppressor. The encoded protein is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regulator of neurogenesis. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2018]

GeneCards Summary for REST Gene

REST (RE1 Silencing Transcription Factor) is a Protein Coding gene. Diseases associated with REST include Wilms Tumor 6 and Fibromatosis, Gingival, 5. Among its related pathways are Signaling pathways regulating pluripotency of stem cells and Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3. Gene Ontology (GO) annotations related to this gene include DNA-binding transcription factor activity and transcription factor binding. An important paralog of this gene is ZNF518A.

UniProtKB/Swiss-Prot Summary for REST Gene

  • Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells (PubMed:12399542, PubMed:26551668, PubMed:7697725, PubMed:7871435, PubMed:8568247, PubMed:11741002, PubMed:11779185). Restricts the expression of neuronal genes by associating with two distinct corepressors, SIN3A and RCOR1, which in turn recruit histone deacetylase to the promoters of REST-regulated genes (PubMed:10449787, PubMed:10734093). Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier (By similarity). Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression (PubMed:19061646). Represses the expression of SRRM4 in non-neural cells to prevent the activation of neural-specific splicing events and to prevent production of REST isoform 3 (By similarity). Repressor activity may be inhibited by forming heterodimers with isoform 3, thereby preventing binding to NRSE or binding to corepressors and leading to derepression of target genes (PubMed:11779185). Also maintains repression of neuronal genes in neural stem cells, and allows transcription and differentiation into neurons by dissociation from RE1/NRSE sites of target genes (By similarity). Thereby is involved in maintaining the quiescent state of adult neural stem cells and preventing premature differentiation into mature neurons (PubMed:21258371). Plays a role in the developmental switch in synaptic NMDA receptor composition during postnatal development, by repressing GRIN2B expression and thereby altering NMDA receptor properties from containing primarily GRIN2B to primarily GRIN2A subunits (By similarity). Acts as a regulator of osteoblast differentiation (By similarity). Key repressor of gene expression in hypoxia; represses genes in hypoxia by direct binding to an RE1/NRSE site on their promoter regions (PubMed:27531581). May also function in stress resistance in the brain during aging; possibly by regulating expression of genes involved in cell death and in the stress response (PubMed:24670762). Repressor of gene expression in the hippocampus after ischemia by directly binding to RE1/NRSE sites and recruiting SIN3A and RCOR1 to promoters of target genes, thereby promoting changes in chromatin modifications and ischemia-induced cell death (By similarity). After ischemia, might play a role in repression of miR-132 expression in hippocampal neurons, thereby leading to neuronal cell death (By similarity). Negatively regulates the expression of SRRM3 in breast cancer cell lines (PubMed:26053433).
  • Isoform 3: Binds to the 3' region of the neuron-restrictive silencer element (NRSE), with lower affinity than full-length REST isoform 1 (By similarity). Exhibits weaker repressor activity compared to isoform 1 (PubMed:11779185). May negatively regulate the repressor activity of isoform 1 by binding to isoform 1, thereby preventing its binding to NRSE and leading to derepression of target genes (PubMed:11779185). However, in another study, does not appear to be implicated in repressor activity of a NRSE motif-containing reporter construct nor in inhibitory activity on the isoform 1 transcriptional repressor activity (PubMed:11741002). Post-transcriptional inactivation of REST by SRRM4-dependent alternative splicing into isoform 3 is required in mechanosensory hair cells in the inner ear for derepression of neuronal genes and hearing (By similarity).

Gene Wiki entry for REST Gene

Additional gene information for REST Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for REST Gene

Genomics for REST Gene

GeneHancer (GH) Regulatory Elements for REST Gene

Promoters and enhancers for REST Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around REST on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the REST gene promoter:
  • C/EBPalpha
  • CREB
  • deltaCREB
  • Lmo2
  • NRSF form 1
  • NRSF form 2
  • POU2F1
  • POU2F1a
  • YY1

Genomic Locations for REST Gene

Genomic Locations for REST Gene
chr4:56,907,876-56,966,678
(GRCh38/hg38)
Size:
58,803 bases
Orientation:
Plus strand
chr4:57,774,042-57,802,010
(GRCh37/hg19)
Size:
27,969 bases
Orientation:
Plus strand

Genomic View for REST Gene

Genes around REST on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
REST Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for REST Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for REST Gene

Proteins for REST Gene

  • Protein details for REST Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13127-REST_HUMAN
    Recommended name:
    RE1-silencing transcription factor
    Protein Accession:
    Q13127
    Secondary Accessions:
    • A2RUE0
    • B9EGJ0
    • Q12956
    • Q12957
    • Q13134
    • Q59ER1
    • Q8IWI3

    Protein attributes for REST Gene

    Size:
    1097 amino acids
    Molecular mass:
    121872 Da
    Quaternary structure:
    • Isoform 1 and isoform 3 form heterodimers (By similarity). Isoform 3: Forms homodimers and homooligomers; binds to the neuron-restrictive silencer element (NRSE) as monomer (By similarity). Interacts with SIN3A, SIN3B and RCOR1 (PubMed:10449787, PubMed:10734093, PubMed:16288918). Interacts with CDYL (PubMed:19061646). Interacts with EHMT1 and EHMT2 only in the presence of CDYL (PubMed:19061646). Part of a complex containing at least CDYL, REST, WIZ, SETB1, EHMT1 and EHMT2 (PubMed:19061646). Interacts (via zinc-finger DNA-binding domain) with ZFP90 (via N- and C-termini); the interaction inhibits REST repressor activity (PubMed:21284946). Interacts (via C2H2-type zinc finger 5) with PRICKLE1 (PubMed:14645515, PubMed:16442230). Interacts with FBXW11 and BTRC (PubMed:18354482). Interacts with USP7 (PubMed:21258371).
    SequenceCaution:
    • Sequence=AAA98503.1; Type=Frameshift; Positions=188, 198, 202, 212, 1087; Evidence={ECO:0000305}; Sequence=AAC50114.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAC50115.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAH38985.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305}; Sequence=BAD92987.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for REST Gene

    Alternative splice isoforms for REST Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for REST Gene

Post-translational modifications for REST Gene

  • O-glycosylated.
  • Phosphorylated; phosphorylation is required for ubiquitination.
  • Ubiquitinated; ubiquitination is mediated by BTRC and leads to proteasomal degradation in G2 phase (PubMed:18354482, PubMed:21258371). Ubiquitination increases during neuronal differentiation (PubMed:21258371). Deubiquitinated by USP7; leading to its stabilization and promoting the maintenance of neural progenitor cells (PubMed:21258371).
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for REST Gene

Domains & Families for REST Gene

Gene Families for REST Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for REST Gene

Suggested Antigen Peptide Sequences for REST Gene

GenScript: Design optimal peptide antigens:
  • X2 box repressor (REST_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q13127

UniProtKB/Swiss-Prot:

REST_HUMAN :
  • The C2H2-type zinc finger 5 is required for nuclear localization.
Domain:
  • The C2H2-type zinc finger 5 is required for nuclear localization.
genes like me logo Genes that share domains with REST: view

Function for REST Gene

Molecular function for REST Gene

UniProtKB/Swiss-Prot Function:
Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells (PubMed:12399542, PubMed:26551668, PubMed:7697725, PubMed:7871435, PubMed:8568247, PubMed:11741002, PubMed:11779185). Restricts the expression of neuronal genes by associating with two distinct corepressors, SIN3A and RCOR1, which in turn recruit histone deacetylase to the promoters of REST-regulated genes (PubMed:10449787, PubMed:10734093). Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier (By similarity). Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression (PubMed:19061646). Represses the expression of SRRM4 in non-neural cells to prevent the activation of neural-specific splicing events and to prevent production of REST isoform 3 (By similarity). Repressor activity may be inhibited by forming heterodimers with isoform 3, thereby preventing binding to NRSE or binding to corepressors and leading to derepression of target genes (PubMed:11779185). Also maintains repression of neuronal genes in neural stem cells, and allows transcription and differentiation into neurons by dissociation from RE1/NRSE sites of target genes (By similarity). Thereby is involved in maintaining the quiescent state of adult neural stem cells and preventing premature differentiation into mature neurons (PubMed:21258371). Plays a role in the developmental switch in synaptic NMDA receptor composition during postnatal development, by repressing GRIN2B expression and thereby altering NMDA receptor properties from containing primarily GRIN2B to primarily GRIN2A subunits (By similarity). Acts as a regulator of osteoblast differentiation (By similarity). Key repressor of gene expression in hypoxia; represses genes in hypoxia by direct binding to an RE1/NRSE site on their promoter regions (PubMed:27531581). May also function in stress resistance in the brain during aging; possibly by regulating expression of genes involved in cell death and in the stress response (PubMed:24670762). Repressor of gene expression in the hippocampus after ischemia by directly binding to RE1/NRSE sites and recruiting SIN3A and RCOR1 to promoters of target genes, thereby promoting changes in chromatin modifications and ischemia-induced cell death (By similarity). After ischemia, might play a role in repression of miR-132 expression in hippocampal neurons, thereby leading to neuronal cell death (By similarity). Negatively regulates the expression of SRRM3 in breast cancer cell lines (PubMed:26053433).
UniProtKB/Swiss-Prot Function:
Isoform 3: Binds to the 3' region of the neuron-restrictive silencer element (NRSE), with lower affinity than full-length REST isoform 1 (By similarity). Exhibits weaker repressor activity compared to isoform 1 (PubMed:11779185). May negatively regulate the repressor activity of isoform 1 by binding to isoform 1, thereby preventing its binding to NRSE and leading to derepression of target genes (PubMed:11779185). However, in another study, does not appear to be implicated in repressor activity of a NRSE motif-containing reporter construct nor in inhibitory activity on the isoform 1 transcriptional repressor activity (PubMed:11741002). Post-transcriptional inactivation of REST by SRRM4-dependent alternative splicing into isoform 3 is required in mechanosensory hair cells in the inner ear for derepression of neuronal genes and hearing (By similarity).
UniProtKB/Swiss-Prot Induction:
Up-regulated by Wnt signaling (PubMed:24670762). Up-regulated in the brain of aging individuals but not in Alzheimer disease patients (PubMed:24670762). Up-regulated by oxidative stress (PubMed:24670762). Down-regulated during neural progenitor cell differentiation (PubMed:21258371).
GENATLAS Biochemistry:
RE1 silencing transcription factor

Phenotypes From GWAS Catalog for REST Gene

Gene Ontology (GO) - Molecular Function for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000976 transcription regulatory region sequence-specific DNA binding IEA --
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IDA 8568247
GO:0000979 RNA polymerase II core promoter sequence-specific DNA binding IBA 21873635
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific IEA,NAS 19274049
GO:0001227 DNA-binding transcription repressor activity, RNA polymerase II-specific IDA 10449787
genes like me logo Genes that share ontologies with REST: view
genes like me logo Genes that share phenotypes with REST: view

Human Phenotype Ontology for REST Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for REST Gene

MGI Knock Outs for REST:
  • Rest Rest<tm2b(EUCOMM)Wtsi>
  • Rest Rest<tm1Ymat>
  • Rest Rest<tm1And>
  • Rest Rest<tm1.2Yasu>

Animal Model Products

CRISPR Products

miRNA for REST Gene

miRTarBase miRNAs that target REST
Targeted motifs for REST Gene
HOMER Transcription Factor Regulatory Elements motif REST
  • Consensus sequence: GGAGCTGTCCATGGTGCTGA Submotif: canonical Cell Type: Jurkat

Clone Products

  • Addgene plasmids for REST

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for REST Gene

Localization for REST Gene

Subcellular locations from UniProtKB/Swiss-Prot for REST Gene

Nucleus. Cytoplasm. Note=Colocalizes with ZFP90 in the nucleus (By similarity). In response to hypoxia, there is a more pronounced increase in levels in the nucleus as compared to the cytoplasm (PubMed:27531581). In aging neurons, increased levels in the nucleus as compared to the cytoplasm (PubMed:24670762, PubMed:30684677). {ECO:0000250 UniProtKB:Q8VIG1, ECO:0000269 PubMed:24670762, ECO:0000269 PubMed:27531581, ECO:0000269 PubMed:30684677}.
Isoform 2: Cytoplasm.
Isoform 3: Nucleus.
Isoform 4: Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for REST gene
Compartment Confidence
nucleus 5
cytosol 3
plasma membrane 1
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,NAS 7871435
GO:0005654 nucleoplasm TAS --
GO:0005737 cytoplasm IEA,IDA 24670762
GO:0005829 cytosol IEA --
GO:0017053 transcriptional repressor complex IDA 10734093
genes like me logo Genes that share ontologies with REST: view

Pathways & Interactions for REST Gene

genes like me logo Genes that share pathways with REST: view

Pathways by source for REST Gene

2 Qiagen pathways for REST Gene
  • Transcriptional Regulatory Network in Embryonic Stem Cell
  • WNT Signaling

SIGNOR curated interactions for REST Gene

Inactivates:
Is activated by:

Gene Ontology (GO) - Biological Process for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II TAS 7697725
GO:0000381 regulation of alternative mRNA splicing, via spliceosome ISS --
GO:0001666 response to hypoxia IDA 27531581
GO:0002244 hematopoietic progenitor cell differentiation IEA --
GO:0002931 response to ischemia ISS --
genes like me logo Genes that share ontologies with REST: view

Drugs & Compounds for REST Gene

(6) Drugs for REST Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for REST Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with REST: view

Transcripts for REST Gene

CRISPR Products

Clone Products

  • Addgene plasmids for REST

Alternative Splicing Database (ASD) splice patterns (SP) for REST Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b
SP1: - -
SP2: -
SP3:

Relevant External Links for REST Gene

GeneLoc Exon Structure for
REST
ECgene alternative splicing isoforms for
REST

Expression for REST Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for REST Gene

Protein differential expression in normal tissues from HIPED for REST Gene

This gene is overexpressed in Serum (68.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for REST Gene



Protein tissue co-expression partners for REST Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of REST Gene:

REST

SOURCE GeneReport for Unigene cluster for REST Gene:

Hs.307836

mRNA Expression by UniProt/SwissProt for REST Gene:

Q13127-REST_HUMAN
Tissue specificity: Expressed in neurons of the prefrontal cortex, in hippocampal pyramidal neurons, dentate gyrus granule neurons and cerebellar Purkinje and granule neurons (at protein level) (PubMed:24670762). Expressed in dopaminergic neurons of the substantia nigra (at protein level) (PubMed:30684677). Expressed in neural progenitor cells (at protein level) (PubMed:21258371). In patients suffering from Alzheimer disease, frontotemporal dementia or dementia with Lewy bodies, decreased nuclear levels have been observed in neurons of the prefrontal cortex and the hippocampus, but not in neurons of the dentate gyrus and cerebellum (at protein level) (PubMed:24670762). In patients with Parkinson disease or dementia with Lewy bodies, decreased nuclear levels have been observed in dopaminergic neurons and in cortical neurons and localization to Lewy bodies and pale bodies was detected (at protein level) (PubMed:30684677). Expressed at higher levels in weakly invasive breast cancer cell lines and at lower levels in highly invasive breast cancer lines (at protein level) (PubMed:26053433). Ubiquitous (PubMed:8568247). Expressed at higher levels in the tissues of the lymphocytic compartment, including spleen, thymus, peripheral blood lymphocytes and ovary (PubMed:8568247).

Evidence on tissue expression from TISSUES for REST Gene

  • Nervous system(4.6)
genes like me logo Genes that share expression patterns with REST: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for REST Gene

Orthologs for REST Gene

This gene was present in the common ancestor of animals.

Orthologs for REST Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia REST 33 32
  • 99.21 (n)
OneToOne
dog
(Canis familiaris)
Mammalia REST 33 32
  • 85.9 (n)
OneToOne
cow
(Bos Taurus)
Mammalia REST 32
  • 85.15 (n)
-- 33
  • 75 (a)
OneToMany
MGC157163 33
  • 74 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia Rest 32
  • 74.22 (n)
mouse
(Mus musculus)
Mammalia Rest 17 33 32
  • 73.08 (n)
oppossum
(Monodelphis domestica)
Mammalia REST 33
  • 70 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia REST 33
  • 48 (a)
OneToOne
chicken
(Gallus gallus)
Aves REST 33 32
  • 71.01 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia REST 33
  • 48 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia rest-A 32
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.10667 32
zebrafish
(Danio rerio)
Actinopterygii rest 33
  • 37 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG31612 33
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.1932 33
  • 20 (a)
OneToOne
Species where no ortholog for REST was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for REST Gene

ENSEMBL:
Gene Tree for REST (if available)
TreeFam:
Gene Tree for REST (if available)
Aminode:
Evolutionary constrained regions (ECRs) for REST: view image

Paralogs for REST Gene

Pseudogenes.org Pseudogenes for REST Gene

genes like me logo Genes that share paralogs with REST: view

Variants for REST Gene

Sequence variations from dbSNP and Humsavar for REST Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs1553904077 pathogenic, likely-pathogenic, FIBROMATOSIS, GINGIVAL, 5, Gingival fibromatosis 1 56,930,168(+) T/A coding_sequence_variant, stop_gained
rs1553904346 pathogenic, likely-pathogenic, FIBROMATOSIS, GINGIVAL, 5, Gingival fibromatosis 1 56,931,268(+) CCCC/CCC coding_sequence_variant, frameshift
rs1553904378 uncertain-significance, Inborn genetic diseases 56,931,373(+) G/T coding_sequence_variant, stop_gained
rs1553904481 pathogenic, likely-pathogenic, FIBROMATOSIS, GINGIVAL, 5, Gingival fibromatosis 1 56,931,723(+) AA/ coding_sequence_variant, frameshift
rs869025310 risk-factor, Wilms tumor 6 56,911,469(+) AT/ coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for REST Gene

Variant ID Type Subtype PubMed ID
dgv5214n100 CNV gain 25217958
esv22393 CNV loss 19812545
esv2663344 CNV deletion 23128226
nsv1074717 CNV deletion 25765185
nsv1114531 CNV deletion 24896259
nsv594205 CNV gain 21841781
nsv594206 CNV loss 21841781
nsv822562 CNV gain 20364138
nsv967748 CNV duplication 23825009

Variation tolerance for REST Gene

Residual Variation Intolerance Score: 72.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.14; 69.36% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for REST Gene

Human Gene Mutation Database (HGMD)
REST
SNPedia medical, phenotypic, and genealogical associations of SNPs for
REST

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for REST Gene

Disorders for REST Gene

MalaCards: The human disease database

(14) MalaCards diseases for REST Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
wilms tumor 6
  • nephroblastoma
fibromatosis, gingival, 5
  • gingf5
gingival fibromatosis
  • fibromatosis, gingival, hereditary
deafness, autosomal dominant 27
  • dfna27
fibromatosis
- elite association - COSMIC cancer census association via MalaCards
Search REST in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

REST_HUMAN
  • Wilms tumor 6 (WT6) [MIM:616806]: A pediatric malignancy of kidney, and the most common childhood abdominal malignancy. It is caused by the uncontrolled multiplication of renal stem, stromal, and epithelial cells. {ECO:0000269 PubMed:26551668}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
  • Fibromatosis, gingival, 5 (GINGF5) [MIM:617626]: An autosomal dominant form of hereditary gingival fibromatosis, a rare condition characterized by a slow, progressive overgrowth of the gingiva. The excess gingival tissue can cover part of or the entire crown, and can result in diastemas, teeth displacement, or retention of primary or impacted teeth. {ECO:0000269 PubMed:28686854}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Note=An intronic variant that affects alternative splicing of REST into isoform 3 and inactivation of REST repressor activity is associated with progressive hearing loss and deafness. {ECO:0000269 PubMed:29961578}.

Additional Disease Information for REST

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with REST: view

No data available for Genatlas for REST Gene

Publications for REST Gene

  1. The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. (PMID: 7871435) Schoenherr CJ … Anderson DJ (Science (New York, N.Y.) 1995) 2 3 4 23 56
  2. Defects in the Alternative Splicing-Dependent Regulation of REST Cause Deafness. (PMID: 29961578) Nakano Y … Bánfi B (Cell 2018) 2 3 4 56
  3. Additive effect of BDNF and REST polymorphisms is associated with improved general cognitive ability. (PMID: 18518926) Miyajima F … Payton A (Genes, brain, and behavior 2008) 3 23 43 56
  4. Characterization of the nuclear targeting signal of REST/NRSF. (PMID: 16442230) Shimojo M (Neuroscience letters 2006) 3 4 23 56
  5. The neural repressor NRSF/REST binds the PAH1 domain of the Sin3 corepressor by using its distinct short hydrophobic helix. (PMID: 16288918) Nomura M … Nishimura Y (Journal of molecular biology 2005) 3 4 23 56

Products for REST Gene

Sources for REST Gene