Free for academic non-profit institutions. Other users need a Commercial license

Aliases for REEP1 Gene

Aliases for REEP1 Gene

  • Receptor Accessory Protein 1 2 3 5
  • Spastic Paraplegia 31 Protein 3 4
  • C2orf23 3 4
  • SPG31 3 4
  • Receptor Expression-Enhancing Protein 1 3
  • Receptor Expression Enhancing Protein 1 2
  • Chromosome 2 Open Reading Frame 23 2
  • HMN5B 3
  • Yip2a 3

External Ids for REEP1 Gene

Previous HGNC Symbols for REEP1 Gene

  • C2orf23

Previous GeneCards Identifiers for REEP1 Gene

  • GC02M086353
  • GC02M086294
  • GC02M086441

Summaries for REEP1 Gene

Entrez Gene Summary for REEP1 Gene

  • This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

GeneCards Summary for REEP1 Gene

REEP1 (Receptor Accessory Protein 1) is a Protein Coding gene. Diseases associated with REEP1 include Spastic Paraplegia 31, Autosomal Dominant and Neuronopathy, Distal Hereditary Motor, Type Vb. Among its related pathways are Signaling by GPCR and Olfactory Signaling Pathway. Gene Ontology (GO) annotations related to this gene include microtubule binding and olfactory receptor binding. An important paralog of this gene is REEP2.

UniProtKB/Swiss-Prot for REEP1 Gene

  • Required for endoplasmic reticulum (ER) network formation, shaping and remodeling; it links ER tubules to the cytoskeleton. May also enhance the cell surface expression of odorant receptors (PubMed:20200447). May play a role in long-term axonal maintenance (PubMed:24478229).

Gene Wiki entry for REEP1 Gene

Additional gene information for REEP1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for REEP1 Gene

Genomics for REEP1 Gene

GeneHancer (GH) Regulatory Elements for REEP1 Gene

Promoters and enhancers for REEP1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J086335 Promoter/Enhancer 2 EPDnew FANTOM5 Ensembl ENCODE 661.6 +1.7 1708 2.2 MXI1 KLF1 USF1 MAX KLF17 SIN3A KLF14 ZNF335 E2F1 ZFHX2 REEP1 POLR1A MRPL35 IMMT GC02M086309
GH02J086222 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 16 +114.0 113976 4 HDGF CTCF MXI1 EBF1 ZIC2 RAD21 IRF4 ZFHX2 POLR2A VEZF1 GC02M086172 MRPL35 IMMT POLR1A REEP1 ENSG00000251974 ENSG00000202537 ENSG00000273080 RNF103 RMND5A
GH02J086392 Enhancer 1 Ensembl ENCODE 18.4 -55.3 -55296 1.6 JUN ZNF133 MAX MZF1 FEZF1 ZEB1 ZNF335 ZFHX2 CTBP1 POLR2A REEP1 ENSG00000251974 KDM3A ENSG00000202537 RNU6-640P CHMP3 POLR1A MRPL35 GC02P086411
GH02J086783 Promoter/Enhancer 2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 6.9 -451.0 -451019 12.6 PKNOX1 ATF1 ZSCAN4 FEZF1 ZNF335 ZNF366 SCRT2 ZNF143 ATF7 BCLAF1 CD8A CD8B CHMP3 RNU6-640P REEP1 ENSG00000231259 RMND5A KDM3A RNF103 LOC105374846
GH02J086216 Enhancer 1.2 Ensembl ENCODE dbSUPER 11.1 +121.2 121208 0.8 HDAC1 PKNOX1 TCF12 EGR1 ZFP91 ZEB2 ZNF592 NFIC KLF16 SMARCA4 IMMT ENSG00000251974 REEP1 ENSG00000202537 KDM3A POLR1A GC02M086172 MRPL35
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around REEP1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the REEP1 gene promoter:
  • POU2F1a
  • POU2F1
  • AML1a
  • p53
  • SRY
  • Pax-2
  • Pax-2a
  • RORalpha1
  • NF-AT4
  • NF-AT3

Genomic Locations for REEP1 Gene

Genomic Locations for REEP1 Gene
124,426 bases
Minus strand
124,091 bases
Minus strand

Genomic View for REEP1 Gene

Genes around REEP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
REEP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for REEP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for REEP1 Gene

Proteins for REEP1 Gene

  • Protein details for REEP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Receptor expression-enhancing protein 1
    Protein Accession:
    Secondary Accessions:
    • B7Z4D7
    • B7Z4F2
    • B7Z5R9
    • D6W5M2
    • Q53TI0

    Protein attributes for REEP1 Gene

    201 amino acids
    Molecular mass:
    22255 Da
    Quaternary structure:
    • Interacts with SPAST and ATL1; it preferentially interacts with SPAST isoform 1 (PubMed:20200447). Interacts (via C-terminus) with microtubules (PubMed:20200447). Interacts with odorant receptor proteins (By similarity). Interacts with ZFYVE27 (PubMed:23969831).

    Alternative splice isoforms for REEP1 Gene


neXtProt entry for REEP1 Gene

Post-translational modifications for REEP1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for REEP1 Gene

Domains & Families for REEP1 Gene

Gene Families for REEP1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted membrane proteins

Protein Domains for REEP1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the DP1 family.
  • Belongs to the DP1 family.
genes like me logo Genes that share domains with REEP1: view

Function for REEP1 Gene

Molecular function for REEP1 Gene

UniProtKB/Swiss-Prot Function:
Required for endoplasmic reticulum (ER) network formation, shaping and remodeling; it links ER tubules to the cytoskeleton. May also enhance the cell surface expression of odorant receptors (PubMed:20200447). May play a role in long-term axonal maintenance (PubMed:24478229).

Phenotypes From GWAS Catalog for REEP1 Gene

Gene Ontology (GO) - Molecular Function for REEP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 20200447
GO:0008017 microtubule binding IDA 20200447
GO:0031849 olfactory receptor binding IMP 15550249
genes like me logo Genes that share ontologies with REEP1: view
genes like me logo Genes that share phenotypes with REEP1: view

Human Phenotype Ontology for REEP1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for REEP1 Gene

MGI Knock Outs for REEP1:

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for REEP1 Gene

Localization for REEP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for REEP1 Gene

Membrane. Mitochondrion membrane; Multi-pass membrane protein. Endoplasmic reticulum. Note=Localizes to endoplasmic reticulum tubular network. {ECO:0000269 PubMed:20200447}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for REEP1 gene
Compartment Confidence
endoplasmic reticulum 5
mitochondrion 4
plasma membrane 2
extracellular 2
peroxisome 1
endosome 1

Gene Ontology (GO) - Cellular Components for REEP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IDA 15550249
GO:0005739 mitochondrion IEA --
GO:0005783 endoplasmic reticulum IDA,IEA 20200447
GO:0005789 endoplasmic reticulum membrane IEA --
GO:0016020 membrane IDA,IEA 20200447
genes like me logo Genes that share ontologies with REEP1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for REEP1 Gene

Pathways & Interactions for REEP1 Gene

genes like me logo Genes that share pathways with REEP1: view

Pathways by source for REEP1 Gene

Interacting Proteins for REEP1 Gene

Gene Ontology (GO) - Biological Process for REEP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0032386 regulation of intracellular transport IEA --
GO:0051205 protein insertion into membrane IDA 15550249
GO:0071786 endoplasmic reticulum tubular network organization IMP 20200447
genes like me logo Genes that share ontologies with REEP1: view

No data available for SIGNOR curated interactions for REEP1 Gene

Drugs & Compounds for REEP1 Gene

No Compound Related Data Available

Transcripts for REEP1 Gene

mRNA/cDNA for REEP1 Gene

Unigene Clusters for REEP1 Gene

Receptor accessory protein 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for REEP1 Gene

No ASD Table

Relevant External Links for REEP1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for REEP1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for REEP1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for REEP1 Gene

This gene is overexpressed in Testis (19.3), Fetal Brain (17.1), Ovary (9.7), and Bone (8.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for REEP1 Gene

Protein tissue co-expression partners for REEP1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of REEP1 Gene:


SOURCE GeneReport for Unigene cluster for REEP1 Gene:


mRNA Expression by UniProt/SwissProt for REEP1 Gene:

Tissue specificity: Expressed in circumvallate papillae and testis.

Evidence on tissue expression from TISSUES for REEP1 Gene

  • Nervous system(5)
  • Liver(4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for REEP1 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • nervous
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • head
  • ankle
  • arm
  • digit
  • finger
  • foot
  • forearm
  • hand
  • lower limb
  • shin
  • thigh
  • upper limb
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with REEP1: view

No data available for mRNA differential expression in normal tissues for REEP1 Gene

Orthologs for REEP1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for REEP1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia REEP1 34 33
  • 100 (n)
(Canis familiaris)
Mammalia LOC613003 33
  • 95.37 (n)
REEP1 34
  • 89 (a)
(Bos Taurus)
Mammalia REEP1 34 33
  • 94.86 (n)
(Rattus norvegicus)
Mammalia Reep1 33
  • 92.04 (n)
(Mus musculus)
Mammalia Reep1 16 34 33
  • 91.71 (n)
(Monodelphis domestica)
Mammalia REEP1 34
  • 91 (a)
(Ornithorhynchus anatinus)
Mammalia REEP1 34
  • 85 (a)
(Gallus gallus)
Aves REEP1 34 33
  • 83.24 (n)
(Anolis carolinensis)
Reptilia REEP1 34
  • 82 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia reep1 33
  • 77.29 (n)
(Danio rerio)
Actinopterygii LOC799901 33
  • 73.87 (n)
reep1 34
  • 66 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG42678 34
  • 15 (a)
CG5539 34
  • 15 (a)
(Caenorhabditis elegans)
Secernentea T19C3.4 34
  • 36 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes YOP1 34
  • 18 (a)
Species where no ortholog for REEP1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for REEP1 Gene

Gene Tree for REEP1 (if available)
Gene Tree for REEP1 (if available)
Evolutionary constrained regions (ECRs) for REEP1: view image

Paralogs for REEP1 Gene

Paralogs for REEP1 Gene

(6) SIMAP similar genes for REEP1 Gene using alignment to 6 proteins:

  • F5H7Z9_HUMAN
  • F8W897_HUMAN
genes like me logo Genes that share paralogs with REEP1: view

Variants for REEP1 Gene

Sequence variations from dbSNP and Humsavar for REEP1 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1060503493 uncertain-significance, Spastic paraplegia 31, autosomal dominant 86,263,981(-) C/T coding_sequence_variant, missense_variant
rs1060503494 pathogenic, Spastic paraplegia 31, autosomal dominant 86,264,034(-) C/T 5_prime_UTR_variant, coding_sequence_variant, stop_gained
rs1060503496 likely-pathogenic, Spastic paraplegia 31, autosomal dominant 86,282,219(-) G/C 5_prime_UTR_variant, coding_sequence_variant, intron_variant, missense_variant
rs1060503497 uncertain-significance, Spastic paraplegia 31, autosomal dominant 86,232,780(-) C/A coding_sequence_variant, missense_variant
rs1064792986 likely-pathogenic, Spastic paraplegia 31, autosomal dominant, not provided 86,232,667(-) GCTGGCCGTGTTTGCCGCTGGCC/GCTGGCC coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for REEP1 Gene

Variant ID Type Subtype PubMed ID
dgv3885n100 CNV gain 25217958
dgv6946n54 CNV gain 21841781
dgv713e214 CNV gain 21293372
esv2657637 CNV deletion 23128226
esv2720301 CNV deletion 23290073
esv2751903 CNV gain 17911159
esv3591540 CNV gain 21293372
nsv1144899 CNV deletion 24896259
nsv458563 CNV gain 19166990
nsv458574 CNV gain 19166990
nsv582372 CNV gain 21841781

Variation tolerance for REEP1 Gene

Residual Variation Intolerance Score: 61.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.45; 9.86% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for REEP1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for REEP1 Gene

Disorders for REEP1 Gene

MalaCards: The human disease database

(21) MalaCards diseases for REEP1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
spastic paraplegia 31, autosomal dominant
  • spg31
neuronopathy, distal hereditary motor, type vb
  • hmn5b
distal hereditary motor neuropathy, type v
  • neuronopathy, distal hereditary motor, type v
spastic paraplegia 31
  • spastic paraplegia 31, autosomal dominant
  • paraplegia, lower
- elite association - COSMIC cancer census association via MalaCards
Search REEP1 in MalaCards View complete list of genes associated with diseases


  • Spastic paraplegia 31, autosomal dominant (SPG31) [MIM:610250]: A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. {ECO:0000269 PubMed:16826527, ECO:0000269 PubMed:18644145, ECO:0000269 PubMed:20718791, ECO:0000269 PubMed:21618648, ECO:0000269 PubMed:22703882, ECO:0000269 PubMed:24478229}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Neuronopathy, distal hereditary motor, 5B (HMN5B) [MIM:614751]: A disorder characterized by distal muscular atrophy mainly affecting the upper extremities, in contrast to other distal motor neuronopathies. These constitute a heterogeneous group of neuromuscular diseases caused by selective degeneration of motor neurons in the anterior horn of the spinal cord, without sensory deficit in the posterior horn. The overall clinical picture consists of a classical distal muscular atrophy syndrome in the legs without clinical sensory loss. The disease starts with weakness and wasting of distal muscles of the anterior tibial and peroneal compartments of the legs. Later on, weakness and atrophy may expand to the proximal muscles of the lower limbs and/or to the distal upper limbs. HMN5B is characterized by onset in the first or second decade of distal muscle weakness and atrophy, primarily affecting the intrinsic hand muscles, but also affecting the lower legs, resulting in abnormal gait and pes cavus. {ECO:0000269 PubMed:22703882}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for REEP1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with REEP1: view

No data available for Genatlas for REEP1 Gene

Publications for REEP1 Gene

  1. Autosomal dominant hereditary spastic paraplegia: novel mutations in the REEP1 gene (SPG31). (PMID: 18644145) Schlang KJ … Stemmler S (BMC medical genetics 2008) 3 4 44 58
  2. Mutations in the novel mitochondrial protein REEP1 cause hereditary spastic paraplegia type 31. (PMID: 16826527) Züchner S … Pericak-Vance MA (American journal of human genetics 2006) 3 4 22 58
  3. RTP family members induce functional expression of mammalian odorant receptors. (PMID: 15550249) Saito H … Matsunami H (Cell 2004) 2 3 4 58
  4. Functional mutation analysis provides evidence for a role of REEP1 in lipid droplet biology. (PMID: 24478229) Falk J … Beetz C (Human mutation 2014) 3 4 58
  5. Protrudin binds atlastins and endoplasmic reticulum-shaping proteins and regulates network formation. (PMID: 23969831) Chang J … Blackstone C (Proceedings of the National Academy of Sciences of the United States of America 2013) 3 4 58

Products for REEP1 Gene

Sources for REEP1 Gene

Loading form....