Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RB1-DT Gene

Subcategory (RNA class) for RB1-DT Gene

non-coding RNA

Quality Score for this RNA gene is

13

Aliases for RB1-DT Gene

  • RB1 Divergent Transcript 2 3 5
  • Long Intergenic Non-Protein Coding RNA 441 2 3
  • NcRNA-RB1 3
  • LINC00441 3

External Ids for RB1-DT Gene

Previous HGNC Symbols for RB1-DT Gene

  • LINC00441

Summaries for RB1-DT Gene

GeneCards Summary for RB1-DT Gene

RB1-DT (RB1 Divergent Transcript) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with RB1-DT include Astrocytoma.

Additional gene information for RB1-DT Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RB1-DT Gene

Genomics for RB1-DT Gene

GeneHancer (GH) Regulatory Elements for RB1-DT Gene

Promoters and enhancers for RB1-DT Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH13J048302 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 600.7 -0.6 -552 4 SP1 ZFX ZNF148 NKRF ZNF121 POLR2A ZNF687 AHR MAFK NCOA6 RB1 RB1-DT RCBTB2 GC13M048317
GH13J048241 Enhancer 1 Ensembl ENCODE dbSUPER 17.8 +56.4 56360 11.8 PKNOX1 SOX13 ZNF10 OSR2 ZNF513 FEZF1 ZNF843 PRDM6 BCL6B RB1 RB1-DT MED4 MED4-AS1 LINC00462 SUCLA2-AS1 ITM2B
GH13J048652 Promoter/Enhancer 2.1 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 4.5 -351.4 -351367 4.3 CEBPG PRDM1 ZNF547 POLR2A RFX1 CEBPA GATAD2A ZSCAN4 TCF7 BMI1 CYSLTR2 RB1-DT FNDC3A GC13P048764
GH13J048264 Enhancer 0.6 ENCODE dbSUPER 13.9 +38.2 38183 2.1 IKZF1 IKZF2 RUNX3 RB1 RB1-DT ITM2B MED4 LINC00462
GH13J048567 Promoter/Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 4.9 -266.3 -266300 5.9 ELF3 CEBPG SOX13 CEBPA SP1 RCOR2 PKNOX1 TCF7 FOXA2 YY1 LOC105370201 RB1 RCBTB2 LPAR6 RB1-DT FNDC3A LINC01077 GC13P048533
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around RB1-DT on UCSC Golden Path with GeneCards custom track

Genomic Locations for RB1-DT Gene

Genomic Locations for RB1-DT Gene
chr13:48,296,513-48,303,661
(GRCh38/hg38)
Size:
7,149 bases
Orientation:
Minus strand
chr13:48,870,649-48,877,797
(GRCh37/hg19)
Size:
7,149 bases
Orientation:
Minus strand

Genomic View for RB1-DT Gene

Genes around RB1-DT on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RB1-DT Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RB1-DT Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RB1-DT Gene

Proteins for RB1-DT Gene

Post-translational modifications for RB1-DT Gene

No Post-translational modifications

No data available for DME Specific Peptides for RB1-DT Gene

Domains & Families for RB1-DT Gene

Gene Families for RB1-DT Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RB1-DT: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RB1-DT Gene

Function for RB1-DT Gene

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RB1-DT Gene

Localization for RB1-DT Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RB1-DT gene
Compartment Confidence
endoplasmic reticulum 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for RB1-DT Gene

Pathways & Interactions for RB1-DT Gene

PathCards logo

SuperPathways for RB1-DT Gene

No Data Available

Interacting Proteins for RB1-DT Gene

Gene Ontology (GO) - Biological Process for RB1-DT Gene

None

No data available for Pathways by source and SIGNOR curated interactions for RB1-DT Gene

Drugs & Compounds for RB1-DT Gene

No Compound Related Data Available

Transcripts for RB1-DT Gene

mRNA/cDNA for RB1-DT Gene

(2) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(3) RNA Central transcripts :

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for RB1-DT Gene

No ASD Table

Relevant External Links for RB1-DT Gene

GeneLoc Exon Structure for
RB1-DT
ECgene alternative splicing isoforms for
RB1-DT

Expression for RB1-DT Gene

NURSA nuclear receptor signaling pathways regulating expression of RB1-DT Gene:

RB1-DT
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for RB1-DT Gene

Orthologs for RB1-DT Gene

Evolution for RB1-DT Gene

ENSEMBL:
Gene Tree for RB1-DT (if available)
TreeFam:
Gene Tree for RB1-DT (if available)

No data available for Orthologs for RB1-DT Gene

Paralogs for RB1-DT Gene

No data available for Paralogs for RB1-DT Gene

Variants for RB1-DT Gene

Sequence variations from dbSNP and Humsavar for RB1-DT Gene

SNP ID Clin Chr 13 pos Variation AA Info Type
rs1014225642 likely-benign, Retinoblastoma 48,303,978(-) A/C/G upstream_transcript_variant
rs1064792974 pathogenic, Retinoblastoma 48,303,948(-) CGCCGCCGCTGCCGCCGCGGAACCCCCGGC/C upstream_transcript_variant
rs1131690845 pathogenic, Hereditary cancer-predisposing syndrome 48,303,931(-) CGA/GG upstream_transcript_variant
rs1131690852 pathogenic, Hereditary cancer-predisposing syndrome 48,303,926(-) CCCCCC/CCCCCCC upstream_transcript_variant
rs1131690855 pathogenic, Hereditary cancer-predisposing syndrome 48,304,050(-) G/T upstream_transcript_variant

Additional Variant Information for RB1-DT Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RB1-DT

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for RB1-DT Gene

Disorders for RB1-DT Gene

MalaCards: The human disease database

(1) MalaCards diseases for RB1-DT Gene - From: LncRNADisease

Disorder Aliases PubMed IDs
astrocytoma
  • astrocytic tumor
- elite association - COSMIC cancer census association via MalaCards
genes like me logo Genes that share disorders with RB1-DT: view

No data available for UniProtKB/Swiss-Prot and Genatlas for RB1-DT Gene

Publications for RB1-DT Gene

  1. A long non-coding RNA links calreticulin-mediated immunogenic cell removal to RB1 transcription. (PMID: 25579178) Musahl AS … Ørom UA (Oncogene 2015) 2 3 58
  2. Bidirectional transcription of Linc00441 and RB1 via H3K27 modification-dependent way promotes hepatocellular carcinoma. (PMID: 28300839) Tang J … Sun B (Cell death & disease 2017) 3 58
  3. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58

Products for RB1-DT Gene

Sources for RB1-DT Gene

Content
Loading form....