Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RASAL2-AS1 Gene

Subcategory (RNA class) for RASAL2-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for RASAL2-AS1 Gene

  • RASAL2 Antisense RNA 1 2 3 5
  • RASAL2 Antisense RNA 1 (Non-Protein Coding) 2

External Ids for RASAL2-AS1 Gene

Summaries for RASAL2-AS1 Gene

GeneCards Summary for RASAL2-AS1 Gene

RASAL2-AS1 (RASAL2 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for RASAL2-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RASAL2-AS1 Gene

Genomics for RASAL2-AS1 Gene

GeneHancer (GH) Regulatory Elements for RASAL2-AS1 Gene

Promoters and enhancers for RASAL2-AS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01I178092 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 557.2 -0.4 -387 4.7 PKNOX1 FOXA2 ARID4B SIN3A DMAP1 ZBTB7B YY1 ZNF213 ZNF207 ZNF143 RASAL2-AS1 RASAL2 LOC105371630 GC01M178037
GH01I178124 Enhancer 1.2 Ensembl ENCODE dbSUPER 21.4 -33.1 -33063 4.5 FOXA2 ARID4B SIN3A BATF RARA ETS1 RFX5 RCOR1 ATF7 FOS LOC105371630 RASAL2-AS1 RASAL2 GC01M178037
GH01I178055 Enhancer 1.1 Ensembl ENCODE 17.7 +36.9 36939 4.1 HDGF FOXA2 ARID4B DMAP1 IRF4 ZNF48 YY1 ZNF143 ATF7 DEK RASAL2 RASAL2-AS1 SEC16B CRYZL2P CRYZL2P-SEC16B GC01M178037
GH01I178051 Enhancer 1.1 Ensembl ENCODE 11.8 +41.4 41351 3 FOXA2 ZFP64 ARID4B DMAP1 YY1 RXRA SP5 MXD4 PPARG KAT8 RASAL2 RASAL2-AS1 CRYZL2P CRYZL2P-SEC16B GC01M178037
GH01I178236 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 8.3 -145.6 -145640 6.6 PKNOX1 FOXA2 INSM2 NEUROD1 SIN3A RAD21 RFX5 ZNF366 ZSCAN5C RCOR1 RASAL2-AS1 RASAL2 ENSG00000270575 LOC105371629
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RASAL2-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for RASAL2-AS1 Gene

Genomic Locations for RASAL2-AS1 Gene
chr1:178,091,508-178,093,993
(GRCh38/hg38)
Size:
2,486 bases
Orientation:
Minus strand
chr1:178,060,643-178,063,128
(GRCh37/hg19)

Genomic View for RASAL2-AS1 Gene

Genes around RASAL2-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RASAL2-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RASAL2-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RASAL2-AS1 Gene

Proteins for RASAL2-AS1 Gene

Post-translational modifications for RASAL2-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for RASAL2-AS1 Gene

Domains & Families for RASAL2-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RASAL2-AS1 Gene

Function for RASAL2-AS1 Gene

Phenotypes From GWAS Catalog for RASAL2-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RASAL2-AS1 Gene

Localization for RASAL2-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for RASAL2-AS1 Gene

Pathways & Interactions for RASAL2-AS1 Gene

SuperPathways for RASAL2-AS1 Gene

No Data Available

Interacting Proteins for RASAL2-AS1 Gene

Gene Ontology (GO) - Biological Process for RASAL2-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for RASAL2-AS1 Gene

Drugs & Compounds for RASAL2-AS1 Gene

No Compound Related Data Available

Transcripts for RASAL2-AS1 Gene

mRNA/cDNA for RASAL2-AS1 Gene

(3) Additional mRNA sequences :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for RASAL2-AS1 Gene

RASAL2 antisense RNA 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for RASAL2-AS1 Gene

No ASD Table

Relevant External Links for RASAL2-AS1 Gene

GeneLoc Exon Structure for
RASAL2-AS1
ECgene alternative splicing isoforms for
RASAL2-AS1

Expression for RASAL2-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RASAL2-AS1 Gene

SOURCE GeneReport for Unigene cluster for RASAL2-AS1 Gene:

Hs.736117
genes like me logo Genes that share expression patterns with RASAL2-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for RASAL2-AS1 Gene

Orthologs for RASAL2-AS1 Gene

Evolution for RASAL2-AS1 Gene

ENSEMBL:
Gene Tree for RASAL2-AS1 (if available)
TreeFam:
Gene Tree for RASAL2-AS1 (if available)

No data available for Orthologs for RASAL2-AS1 Gene

Paralogs for RASAL2-AS1 Gene

No data available for Paralogs for RASAL2-AS1 Gene

Variants for RASAL2-AS1 Gene

Sequence variations from dbSNP and Humsavar for RASAL2-AS1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1000019746 -- 178,095,798(-) G/C upstream_transcript_variant
rs1000849597 -- 178,095,711(-) G/A upstream_transcript_variant
rs1001751356 -- 178,092,414(-) AAGCAAGCAAGCAAGCAAGCAAGCA/AAGCAAGCAAGCAAGCAAGCAAGCAAGCA non_coding_transcript_variant
rs1001854443 -- 178,094,270(-) C/T upstream_transcript_variant
rs1002094975 -- 178,094,108(-) C/G/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for RASAL2-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv548252 CNV gain 21841781

Additional Variant Information for RASAL2-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RASAL2-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for RASAL2-AS1 Gene

Disorders for RASAL2-AS1 Gene

Additional Disease Information for RASAL2-AS1

No disorders were found for RASAL2-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RASAL2-AS1 Gene

Publications for RASAL2-AS1 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58

Products for RASAL2-AS1 Gene

Sources for RASAL2-AS1 Gene

Content
Loading form....