Free for academic non-profit institutions. Other users need a Commercial license

PTPN6 Gene(Protein Coding)

Protein Tyrosine Phosphatase, Non-Receptor Type 6

GCID:
GC12P007499
GIFtS:
55
Genes Participants
UDN Logo

Aliases for PTPN6 Gene

Aliases for PTPN6 Gene

  • Protein Tyrosine Phosphatase, Non-Receptor Type 6 2 3 5
  • Hematopoietic Cell Protein-Tyrosine Phosphatase 3 4
  • Protein-Tyrosine Phosphatase SHP-1 3 4
  • Protein-Tyrosine Phosphatase 1C 3 4
  • SH-PTP1 3 4
  • PTP-1C 3 4
  • HCP 3 4
  • Tyrosine-Protein Phosphatase Non-Receptor Type 6 3
  • Hematopoietic Cell Phosphatase 3
  • EC 3.1.3.48 4
  • HPTP1C 3
  • SHP-1L 3
  • SHP-1 3
  • PTP1C 4
  • HCPH 3
  • SHP1 3

External Ids for PTPN6 Gene

Previous GeneCards Identifiers for PTPN6 Gene

  • GC12M007143
  • GC12M007227
  • GC12P006935
  • GC12P006926
  • GC12P006911
  • GC12P007055
  • GC12P007018
  • GC12P007071
  • GC12P007217
  • GC12P007269
  • GC12P007318
  • GC12P007367
  • GC12P007412
  • GC12P007455

Summaries for PTPN6 Gene

Entrez Gene Summary for PTPN6 Gene

  • The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]

GeneCards Summary for PTPN6 Gene

PTPN6 (Protein Tyrosine Phosphatase, Non-Receptor Type 6) is a Protein Coding gene. Diseases associated with PTPN6 include Cd45 Deficiency and Temtamy Syndrome. Among its related pathways are T cell receptor signaling pathway and Toll-like Receptor Signaling Pathway. Gene Ontology (GO) annotations related to this gene include protein kinase binding and SH3 domain binding. An important paralog of this gene is PTPN11.

UniProtKB/Swiss-Prot for PTPN6 Gene

  • Modulates signaling by tyrosine phosphorylated cell surface receptors such as KIT and the EGF receptor/EGFR. The SH2 regions may interact with other cellular components to modulate its own phosphatase activity against interacting substrates. Together with MTUS1, induces UBE2V2 expression upon angiotensin II stimulation. Plays a key role in hematopoiesis.

Tocris Summary for PTPN6 Gene

  • Protein tyrosine phosphatases (PTPs) are a group of enzymes that catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They directly oppose the actions of kinase and phosphorylase enzymes.

Gene Wiki entry for PTPN6 Gene

Additional gene information for PTPN6 Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PTPN6 Gene

Genomics for PTPN6 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for PTPN6 Gene

Promoters and enhancers for PTPN6 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH12J006940 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 658 +7.2 7190 25.9 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 PTPN6 C12orf57 EMG1 ZNF384 ENSG00000219410 ENSG00000247853 SPSB2 SCARNA12 NCAPD2 ENSG00000256967
GH12J006762 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 16 -180.1 -180064 7.2 ZFP64 FEZF1 YY1 E2F8 ZNF143 SP3 NFYC MEF2D ZNF610 GLIS1 MLF2 PTMS ZNF384 ENSG00000219410 CHD4 ENSG00000247853 SPSB2 ENSG00000256967 ENSG00000126749 C1RL-AS1
GH12J006449 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 15.9 -494.4 -494411 4.4 PKNOX1 CLOCK MLX ARID4B SIN3A DMAP1 YY1 SLC30A9 ZNF766 ZNF207 TAPBPL CD27-AS1 MRPL51 PTPN6 VAMP1 CD27 ENSG00000276718
GH12J006788 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.9 -155.4 -155392 5 HDGF FOXA2 MLX ARID4B SIN3A ZNF48 YY1 SLC30A9 ZFP91 SP5 CD4 LPAR5 GPR162 P3H3 PTPN6 ING4 PTMS MLF2 GNB3 PIANP
GH12J006745 Enhancer 1.1 FANTOM5 Ensembl ENCODE 6.3 -200.6 -200551 1.7 CTCF BCOR YY2 ZBTB2 MAX REST ZNF592 GABPA POLR2A GABPB1 GC12P006747 MLF2 ENSG00000269892 PTPN6 CD4 CHD4 TAPBPL VAMP1 ZNF384
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PTPN6 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PTPN6 gene promoter:
  • ATF-2
  • c-Jun
  • STAT1
  • NF-kappaB

Genomic Locations for PTPN6 Gene

Genomic Locations for PTPN6 Gene
chr12:6,946,468-6,961,316
(GRCh38/hg38)
Size:
14,849 bases
Orientation:
Plus strand
chr12:7,055,631-7,070,479
(GRCh37/hg19)
Size:
14,849 bases
Orientation:
Plus strand

Genomic View for PTPN6 Gene

Genes around PTPN6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PTPN6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PTPN6 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for PTPN6 Gene

Proteins for PTPN6 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for PTPN6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P29350-PTN6_HUMAN
    Recommended name:
    Tyrosine-protein phosphatase non-receptor type 6
    Protein Accession:
    P29350
    Secondary Accessions:
    • A8K306
    • G3V0F8
    • Q969V8
    • Q9UK67

    Protein attributes for PTPN6 Gene

    Size:
    595 amino acids
    Molecular mass:
    67561 Da
    Quaternary structure:
    • Monomer. Interacts with MTUS1 (By similarity). Interacts with MILR1 (tyrosine-phosphorylated) (By similarity). Interacts with KIT (By similarity). Interacts with SIRPA/PTPNS1 (PubMed:9712903). Interacts with LILRB1 and LILRB2 (PubMed:9285411, PubMed:9842885). Interacts with FCRL2 and FCRL4 (PubMed:11162587, PubMed:14597715). Interacts with FCRL3 and FCRL6 (tyrosine phosphorylated form) (PubMed:20933011, PubMed:11162587, PubMed:19843936). Interacts with CD84 (PubMed:11414741). Interacts with CD300LF (PubMed:15184070). Interacts with CDK2 (PubMed:21262353). Interacts with KIR2DL1; the interaction is enhanced by ARRB2 (PubMed:18604210). Interacts (via SH2 1 domain) with ROS1; the interaction is direct and promotes ROS1 dephosphorylation (PubMed:11266449). Interacts with EGFR; inhibits EGFR-dependent activation of MAPK/ERK (PubMed:21258366). Interacts with LYN (PubMed:10574931). Interacts with the tyrosine phosphorylated form of PDPK1 (PubMed:19591923). Interacts with CEACAM1 (via cytoplasmic domain); this interaction depends on the monomer/dimer equilibrium and is phosphorylation-dependent (By similarity). Interacts with MPIG6B (via ITIM motif) (PubMed:23112346).

    Three dimensional structures from OCA and Proteopedia for PTPN6 Gene

    Alternative splice isoforms for PTPN6 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for PTPN6 Gene

Protein Expression for PTPN6 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for PTPN6 Gene

  • Phosphorylated on tyrosine residues. Binding of KITLG/SCF to KIT increases tyrosine phosphorylation (By similarity). Phosphorylation at Tyr-564 enhances phosphatase activity.
  • Ubiquitination at Lys391, Lys308, and Lys277
  • Modification sites at PhosphoSitePlus

Other Protein References for PTPN6 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for PTPN6

No data available for DME Specific Peptides for PTPN6 Gene

Domains & Families for PTPN6 Gene

Gene Families for PTPN6 Gene

HGNC:
Human Protein Atlas (HPA):
  • Enzymes
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for PTPN6 Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for PTPN6 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P29350

UniProtKB/Swiss-Prot:

PTN6_HUMAN :
  • The N-terminal SH2 domain functions as an auto-inhibitory domain, blocking the catalytic domain in the ligand-free close conformation.
  • Belongs to the protein-tyrosine phosphatase family. Non-receptor class 2 subfamily.
Domain:
  • The N-terminal SH2 domain functions as an auto-inhibitory domain, blocking the catalytic domain in the ligand-free close conformation.
Family:
  • Belongs to the protein-tyrosine phosphatase family. Non-receptor class 2 subfamily.
genes like me logo Genes that share domains with PTPN6: view

Function for PTPN6 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for PTPN6 Gene

UniProtKB/Swiss-Prot Function:
Modulates signaling by tyrosine phosphorylated cell surface receptors such as KIT and the EGF receptor/EGFR. The SH2 regions may interact with other cellular components to modulate its own phosphatase activity against interacting substrates. Together with MTUS1, induces UBE2V2 expression upon angiotensin II stimulation. Plays a key role in hematopoiesis.
UniProtKB/Swiss-Prot CatalyticActivity:
Protein tyrosine phosphate + H(2)O = protein tyrosine + phosphate.
GENATLAS Biochemistry:
protein tyrosine phosphatase,non receptor type 6,with two SH2 domains,expressed in hematopoietic cells,overexpressed in neutrophils cells from patients with severe congenital neutropenia (defective dephosphorylation of proteins involved in signaling pathways)

Enzyme Numbers (IUBMB) for PTPN6 Gene

Phenotypes From GWAS Catalog for PTPN6 Gene

Gene Ontology (GO) - Molecular Function for PTPN6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001784 phosphotyrosine residue binding IPI 11986327
GO:0004721 phosphoprotein phosphatase activity IEA --
GO:0004725 protein tyrosine phosphatase activity TAS --
GO:0005001 transmembrane receptor protein tyrosine phosphatase activity IDA 11266449
GO:0005515 protein binding IPI 7228577
genes like me logo Genes that share ontologies with PTPN6: view
genes like me logo Genes that share phenotypes with PTPN6: view

Animal Model Products

Clone Products

  • Addgene plasmids for PTPN6

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PTPN6 Gene

Localization for PTPN6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PTPN6 Gene

Cytoplasm. Nucleus. Note=In neurons, translocates into the nucleus after treatment with angiotensin II (By similarity). Shuttles between the cytoplasm and nucleus via its association with PDPK1. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PTPN6 gene
Compartment Confidence
extracellular 5
nucleus 5
cytosol 5
plasma membrane 3
mitochondrion 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli (3)
  • Nucleus (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PTPN6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005634 nucleus IDA 19838216
GO:0005654 nucleoplasm TAS --
GO:0005730 nucleolus IDA --
GO:0005737 cytoplasm IDA,IEA 10940933
genes like me logo Genes that share ontologies with PTPN6: view

Pathways & Interactions for PTPN6 Gene

genes like me logo Genes that share pathways with PTPN6: view

SIGNOR curated interactions for PTPN6 Gene

Activates:
Inactivates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for PTPN6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002244 hematopoietic progenitor cell differentiation IEA --
GO:0002924 negative regulation of humoral immune response mediated by circulating immunoglobulin IEA --
GO:0006470 protein dephosphorylation IDA 11266449
GO:0006915 apoptotic process TAS 10506221
GO:0007186 G-protein coupled receptor signaling pathway TAS 7781604
genes like me logo Genes that share ontologies with PTPN6: view

Drugs & Compounds for PTPN6 Gene

Products:

  1. Drug

(29) Drugs for PTPN6 Gene - From: HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Phosphoric acid Approved Pharma 0
Water Approved Pharma 0
BVT 948 Pharma PTPs inhibitor,cell-permeable and non-competitve, Non-competitive protein tyrosine phosphatase inhibitor; enhances insulin signaling 0
NSC 87877 Pharma Shp2 /shp1 PTP inhibitor, Potent inhibitor of shp2 and shp1 PTP 0
sodium orthovanadate Pharma PTP inhibitor, Protein tyrosine phosphatase inhibitor 0

(23) Additional Compounds for PTPN6 Gene - From: Novoseek, HMDB, and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Phosphate
  • [po(OH)3]
  • Acide phosphorique
  • Acidum phosphoricum
  • H3PO4
  • Orthophosphoric acid
 14265-44-2
VO-OHpic
675848-25-6

(5) Tocris Compounds for PTPN6 Gene

Compound Action Cas Number
BVT 948 Non-competitive protein tyrosine phosphatase inhibitor; enhances insulin signaling 39674-97-0
NSC 87877 Potent inhibitor of shp2 and shp1 PTP 56990-57-9
Sodium orthovanadate Protein tyrosine phosphatase inhibitor 13721-39-6
TCS 401 Selective inhibitor of PTP1B 243966-09-8
VO-OHpic Potent PTEN inhibitor 675848-25-6
genes like me logo Genes that share compounds with PTPN6: view

Transcripts for PTPN6 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for PTPN6 Gene

(6) REFSEQ mRNAs :
(12) Additional mRNA sequences :
(11) Selected AceView cDNA sequences:
(23) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PTPN6 Gene

Protein tyrosine phosphatase, non-receptor type 6:
Representative Sequences:

Clone Products

  • Addgene plasmids for PTPN6

Alternative Splicing Database (ASD) splice patterns (SP) for PTPN6 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b ^ 3a · 3b · 3c · 3d · 3e · 3f · 3g ^ 4a · 4b ^ 5a · 5b · 5c · 5d · 5e ^ 6 ^ 7a · 7b · 7c ^ 8a · 8b ^
SP1: - - - - - - - - - - - - -
SP2: - - - -
SP3: - - - -
SP4: - - - -
SP5: - - - - - -
SP6:
SP7: - - - - - - - - - - - - - - - -
SP8: - - - - - - - -
SP9: - - -
SP10: - - - - - - - - - - - - - - -
SP11: - - - - - - - - - - - - - -
SP12: - - -
SP13: - - - - -
SP14: - - - - -
SP15: - - -
SP16: - - - -
SP17: - - - - - -
SP18: - - - - - - - - - - - - -
SP19: - -
SP20:
SP21:

ExUns: 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17a · 17b ^ 18 ^ 19a · 19b ^ 20a · 20b ^ 21a · 21b
SP1: - - -
SP2: - - -
SP3: - -
SP4:
SP5:
SP6: - -
SP7:
SP8:
SP9:
SP10:
SP11:
SP12:
SP13:
SP14:
SP15:
SP16:
SP17:
SP18:
SP19:
SP20:
SP21:

Relevant External Links for PTPN6 Gene

GeneLoc Exon Structure for
PTPN6
ECgene alternative splicing isoforms for
PTPN6

Expression for PTPN6 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PTPN6 Gene

mRNA expression in normal human tissues for PTPN6 Gene
mRNA expression by BioGPS for PTPN6 GenemRNA expression by GTEx for PTPN6 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for PTPN6 Gene

This gene is overexpressed in Whole Blood (x21.6) and Spleen (x5.7).

Protein differential expression in normal tissues from HIPED for PTPN6 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (17.0), Lymph node (10.7), Blymphocyte (8.6), and Monocytes (7.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PTPN6 Gene



Protein tissue co-expression partners for PTPN6 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PTPN6 Gene:

PTPN6

SOURCE GeneReport for Unigene cluster for PTPN6 Gene:

Hs.63489

mRNA Expression by UniProt/SwissProt for PTPN6 Gene:

P29350-PTN6_HUMAN
Tissue specificity: Isoform 1 is expressed in hematopoietic cells. Isoform 2 is expressed in non-hematopoietic cells.

Evidence on tissue expression from TISSUES for PTPN6 Gene

  • Blood(4.8)
  • Spleen(3.8)
  • Lung(2.8)
  • Bone marrow(2.4)
  • Lymph node(2.1)
genes like me logo Genes that share expression patterns with PTPN6: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for PTPN6 Gene

Orthologs for PTPN6 Gene

This gene was present in the common ancestor of animals.

Orthologs for PTPN6 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia PTPN6 34 33
  • 99.5 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia PTPN6 34 33
  • 91.41 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia PTPN6 34 33
  • 91.22 (n)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia PTPN6 34
  • 90 (a)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Ptpn6 33
  • 89.82 (n)
mouse
(Mus musculus)
 Mammalia Ptpn6 16 34 33
  • 89.13 (n)
oppossum
(Monodelphis domestica)
 Mammalia PTPN6 34
  • 87 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves PTPN6 34 33
  • 75.17 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia PTPN6 34
  • 73 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia ptpn6 33
  • 64.26 (n)
zebrafish
(Danio rerio)
 Actinopterygii ptpn6 34 33
  • 64.3 (n)
 OneToMany
-- 33
rainbow trout
(Oncorhynchus mykiss)
 Actinopterygii Omy.10340 33
fruit fly
(Drosophila melanogaster)
 Insecta csw 34
  • 26 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea F47B3.7 35
  • 35 (a)
F47B3.6 35
  • 35 (a)
F47B3.1 35
  • 35 (a)
Y48G9A.9 35
  • 34 (a)
ptp-2 34 35
  • 32 (a)
 OneToMany
C55B7.3 35
  • 32 (a)
sea squirt
(Ciona savignyi)
 Ascidiacea -- 34
  • 55 (a)
 OneToMany
Species where no ortholog for PTPN6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PTPN6 Gene

ENSEMBL:
Gene Tree for PTPN6 (if available)
TreeFam:
Gene Tree for PTPN6 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PTPN6: view image

Paralogs for PTPN6 Gene

Paralogs for PTPN6 Gene

(6) SIMAP similar genes for PTPN6 Gene using alignment to 10 proteins:

  • PTN6_HUMAN
  • F5GXD4_HUMAN
  • F5GY79_HUMAN
  • F5H0N8_HUMAN
  • F5H1V7_HUMAN
  • F5H1Z8_HUMAN
  • F5H4Z1_HUMAN
  • F5H5H9_HUMAN
  • Q53XS4_HUMAN
  • U3KQS1_HUMAN
genes like me logo Genes that share paralogs with PTPN6: view

Variants for PTPN6 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for PTPN6 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs139068225 uncertain-significance, not specified, Temtamy syndrome 6,945,798(+) A/G upstream_transcript_variant
rs199730337 likely-benign, benign, not specified, Temtamy syndrome 6,944,655(+) GGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGG/GGGTCAGACGCGGGAAGGCGGG/GGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGG upstream_transcript_variant
rs587777698 pathogenic, likely-pathogenic, Temtamy syndrome, not provided 6,944,607(+) C/T upstream_transcript_variant
rs868941218 pathogenic, Temtamy syndrome 6,944,575(+) T/A
rs781825705 uncertain-significance, not specified 6,945,781(+) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for PTPN6 Gene

Variant ID Type Subtype PubMed ID
dgv2324n54 CNV loss 21841781
dgv2325n54 CNV loss 21841781
dgv2326n54 CNV loss 21841781
esv3356433 CNV duplication 20981092
esv3381477 CNV insertion 20981092
esv994245 CNV insertion 20482838
nsv1035811 CNV gain 25217958
nsv1047373 CNV gain 25217958
nsv509453 CNV insertion 20534489
nsv513351 CNV insertion 21212237
nsv557262 CNV gain 21841781
nsv952791 CNV deletion 24416366

Variation tolerance for PTPN6 Gene

Residual Variation Intolerance Score: 13.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.15; 23.27% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PTPN6 Gene

Human Gene Mutation Database (HGMD)
PTPN6
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PTPN6

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PTPN6 Gene

Disorders for PTPN6 Gene

MalaCards: The human disease database

(2) MalaCards diseases for PTPN6 Gene - From: HGMD, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
cd45 deficiency
temtamy syndrome
  • temtys
- elite association - COSMIC cancer census association via MalaCards
Search PTPN6 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for PTPN6

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PTPN6: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PTPN6 Gene

Publications for PTPN6 Gene

  1. The nuclear localization of 3'-phosphoinositide-dependent kinase-1 is dependent on its association with the protein tyrosine phosphatase SHP-1. (PMID: 19591923) Sephton CF … Mousseau DD (Cellular signalling 2009) 3 4 22 58
  2. Crystal structure of human protein-tyrosine phosphatase SHP-1. (PMID: 12482860) Yang J … Zhou GW (The Journal of biological chemistry 2003) 3 4 22 58
  3. Human 70-kDa SHP-1L differs from 68-kDa SHP-1 in its C-terminal structure and catalytic activity. (PMID: 10497187) Jin YJ … Burakoff SJ (The Journal of biological chemistry 1999) 3 4 22 58
  4. Functional interaction between SHPTP1 and the Lyn tyrosine kinase in the apoptotic response to DNA damage. (PMID: 10574931) Yoshida K … Kufe D (The Journal of biological chemistry 1999) 3 4 22 58
  5. Tyrosine phosphorylation of an SH2-containing protein tyrosine phosphatase is coupled to platelet thrombin receptor via a pertussis toxin-sensitive heterotrimeric G-protein. (PMID: 7781604) Li RY … Chap H (The EMBO journal 1995) 3 4 22 58

Products for PTPN6 Gene

  • Addgene plasmids for PTPN6