Aliases for PTPN6 Gene
Aliases for PTPN6 Gene
External Ids for PTPN6 Gene
- HGNC: 9658
- Entrez Gene: 5777
- Ensembl: ENSG00000111679
- OMIM: 176883
- UniProtKB: P29350
Previous GeneCards Identifiers for PTPN6 Gene
- GC12M007143
- GC12M007227
- GC12P006935
- GC12P006926
- GC12P006911
- GC12P007055
- GC12P007018
- GC12P007071
- GC12P007217
- GC12P007269
- GC12P007318
- GC12P007367
- GC12P007412
Summaries for PTPN6 Gene
-
The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
GeneCards Summary for PTPN6 Gene
PTPN6 (Protein Tyrosine Phosphatase, Non-Receptor Type 6) is a Protein Coding gene. Diseases associated with PTPN6 include Cd45 Deficiency. Among its related pathways are PAK Pathway and Cytokine Signaling in Immune system. Gene Ontology (GO) annotations related to this gene include protein kinase binding and SH3 domain binding. An important paralog of this gene is PTPN11.
UniProtKB/Swiss-Prot for PTPN6 Gene
-
Modulates signaling by tyrosine phosphorylated cell surface receptors such as KIT and the EGF receptor/EGFR. The SH2 regions may interact with other cellular components to modulate its own phosphatase activity against interacting substrates. Together with MTUS1, induces UBE2V2 expression upon angiotensin II stimulation. Plays a key role in hematopoiesis.
-
Protein tyrosine phosphatases (PTPs) are a group of enzymes that catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They directly oppose the actions of kinase and phosphorylase enzymes.
Additional gene information for PTPN6 Gene
- Monarch Initiative
- Search for PTPN6 at DataMed
- Search for PTPN6 at HumanCyc
No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PTPN6 Gene
Genomics for PTPN6 Gene
GeneHancer (GH) Regulatory Elements for PTPN6 Gene
Promoters and enhancers for PTPN6 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around PTPN6 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the PTPN6 gene promoter:
Regulatory Element Products
Genomic Locations for PTPN6 Gene
Genomic Locations for PTPN6 Gene
- chr12:6,946,468-6,961,316
- (GRCh38/hg38)
- Size:
- 14,849 bases
- Orientation:
- Plus strand
- chr12:7,055,631-7,070,479
- (GRCh37/hg19)
Genomic View for PTPN6 Gene
Genes around PTPN6 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 12p13.31 by Ensembl
- 12p13.31 by Entrez Gene
- 12p13.31 by HGNC
PTPN6 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for PTPN6 Gene
Proteins for PTPN6 Gene
-
Protein details for PTPN6 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P29350-PTN6_HUMAN
- Recommended name:
- Tyrosine-protein phosphatase non-receptor type 6
- Protein Accession:
- P29350
- A8K306
- G3V0F8
- Q969V8
- Q9UK67
Protein attributes for PTPN6 Gene
- Size:
- 595 amino acids
- Molecular mass:
- 67561 Da
- Quaternary structure:
-
- Monomer. Interacts with MTUS1 (By similarity). Interacts with MILR1 (tyrosine-phosphorylated) (By similarity). Interacts with KIT (By similarity). Interacts with SIRPA/PTPNS1 (PubMed:9712903). Interacts with LILRB1 and LILRB2 (PubMed:9285411, PubMed:9842885). Interacts with FCRL2 and FCRL4 (PubMed:11162587, PubMed:14597715). Interacts with FCRL3 and FCRL6 (tyrosine phosphorylated form) (PubMed:20933011, PubMed:11162587, PubMed:19843936). Interacts with CD84 (PubMed:11414741). Interacts with CD300LF (PubMed:15184070). Interacts with CDK2 (PubMed:21262353). Interacts with KIR2DL1; the interaction is enhanced by ARRB2 (PubMed:18604210). Interacts (via SH2 1 domain) with ROS1; the interaction is direct and promotes ROS1 dephosphorylation (PubMed:11266449). Interacts with EGFR; inhibits EGFR-dependent activation of MAPK/ERK (PubMed:21258366). Interacts with LYN (PubMed:10574931). Interacts with the tyrosine phosphorylated form of PDPK1 (PubMed:19591923). Interacts with CEACAM1 (via cytoplasmic domain); this interaction depends on the monomer/dimer equilibrium and is phosphorylation-dependent (By similarity). Interacts with MPIG6B (via ITIM motif) (PubMed:23112346).
Three dimensional structures from OCA and Proteopedia for PTPN6 Gene
Protein Expression for PTPN6 Gene
Selected DME Specific Peptides for PTPN6 Gene
- P29350:
-
- GFWEEFE
- QRSGMVQT
- PIIVHCS
- LKYPLNC
- VQTEAQY
- DYINANY
- WPDHGVP
- FDSLTDLVEH
- DPTSERW
- HCSAGIGR
- KNRYKNILP
- QENSRVIVMTT
- GSFLARPS
Post-translational modifications for PTPN6 Gene
- Phosphorylated on tyrosine residues. Binding of KITLG/SCF to KIT increases tyrosine phosphorylation (By similarity). Phosphorylation at Tyr-564 enhances phosphatase activity.
- Ubiquitination at isoforms=3, 2, 4277, Lys308, and Lys391
Other Protein References for PTPN6 Gene
Antibody Products
- R&D Systems Antibodies for PTPN6 (SHP-1)
- Cell Signaling Technology (CST) Antibodies for PTPN6 (SHP-1)
- Novus Biologicals Antibodies for PTPN6
-
Abcam antibodies for PTPN6
-
Cloud-Clone Corp. Antibodies for PTPN6
- Invitrogen Antibodies for PTPN6
- antibodies-online: Search results for 206 available PTPN6 Antibodies ranked by validation data
- Compare Top PTPN6 Antibodies
-
Recommended
- 2 IHC (p) Antibodies (anti-rat)
- 8 IHC Antibodies (anti-rat)
- 24 IF (p) Antibodies (anti-rat)
- 50 WB Antibodies (anti-rat)
- 1 IF/ICC Antibody (anti-human)
- 1 FACS Antibody (anti-human)
- 2 RIA Antibodies (anti-human)
- 3 IHC (p) Antibodies (anti-human)
- 15 IHC Antibodies (anti-human)
- 26 IF (p) Antibodies (anti-human)
- 148 WB Antibodies (anti-human)
- 2 IHC (p) Antibodies (anti-mouse)
- 10 IHC Antibodies (anti-mouse)
- 24 IF (p) Antibodies (anti-mouse)
- 53 WB Antibodies (anti-mouse)
- GeneTex PTPN6 antibody for PTPN6
-
Santa Cruz Biotechnology (SCBT) Antibodies for PTPN6
- Sino Biological Antibodies for PTPN6
Protein Products
- R&D Systems Proteins and Enzymes for PTPN6 (SHP-1)
- Search Origene for MassSpec and Protein Over-expression Lysates for PTPN6
- Origene Custom Protein Services for PTPN6
- Sino Biological Recombinant Proteins for PTPN6
- Sino Biological Cell Lysates for PTPN6
- ProSpec Recombinant Proteins for PTPN6
-
Cloud-Clone Corp. Proteins for PTPN6
- Search GeneTex for Proteins for PTPN6
-
ProSci Proteins for PTPN6
-
Abcam proteins for PTPN6
Assay Products
- R&D Systems Proteome Profiler Antibody Arrays and other biochemical assays for PTPN6 (SHP-1)
-
Cloud-Clone Corp. Assay Kits for PTPN6
Domains & Families for PTPN6 Gene
Gene Families for PTPN6 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Enzymes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for PTPN6 Gene
Suggested Antigen Peptide Sequences for PTPN6 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P29350UniProtKB/Swiss-Prot:
PTN6_HUMAN :- The N-terminal SH2 domain functions as an auto-inhibitory domain, blocking the catalytic domain in the ligand-free close conformation.
- Belongs to the protein-tyrosine phosphatase family. Non-receptor class 2 subfamily.
- Domain:
-
- The N-terminal SH2 domain functions as an auto-inhibitory domain, blocking the catalytic domain in the ligand-free close conformation.
- Family:
-
- Belongs to the protein-tyrosine phosphatase family. Non-receptor class 2 subfamily.
Function for PTPN6 Gene
Molecular function for PTPN6 Gene
- GENATLAS Biochemistry:
- protein tyrosine phosphatase,non receptor type 6,with two SH2 domains,expressed in hematopoietic cells,overexpressed in neutrophils cells from patients with severe congenital neutropenia (defective dephosphorylation of proteins involved in signaling pathways)
- UniProtKB/Swiss-Prot CatalyticActivity:
- Protein tyrosine phosphate + H(2)O = protein tyrosine + phosphate.
- UniProtKB/Swiss-Prot Function:
- Modulates signaling by tyrosine phosphorylated cell surface receptors such as KIT and the EGF receptor/EGFR. The SH2 regions may interact with other cellular components to modulate its own phosphatase activity against interacting substrates. Together with MTUS1, induces UBE2V2 expression upon angiotensin II stimulation. Plays a key role in hematopoiesis.
Enzyme Numbers (IUBMB) for PTPN6 Gene
Phenotypes From GWAS Catalog for PTPN6 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001784 | phosphotyrosine residue binding | IEA | -- |
| GO:0004721 | phosphoprotein phosphatase activity | IEA | -- |
| GO:0004725 | protein tyrosine phosphatase activity | TAS | -- |
| GO:0005001 | transmembrane receptor protein tyrosine phosphatase activity | IDA | 11266449 |
| GO:0005515 | protein binding | IPI | 7228577 |
Phenotypes for PTPN6 Gene
- MGI mutant phenotypes for PTPN6:
-
inferred from 11 alleles
- nervous system phenotype
- homeostasis/metabolism phenotype
- respiratory system phenotype
- mortality/aging
- immune system phenotype
- cellular phenotype
- growth/size/body region phenotype
- digestive/alimentary phenotype
- endocrine/exocrine gland phenotype
- reproductive system phenotype
- integument phenotype
- hematopoietic system phenotype
- skeleton phenotype
- pigmentation phenotype
- limbs/digits/tail phenotype
- GenomeRNAi human phenotypes for PTPN6:
-
- Increased vaccinia virus (VACV) infection
- Mildly decreased CFP-tsO45G cell surface transport
- Decreased viability in esophageal squamous lineage
- Decreased shRNA abundance (Z-score < -2)
- Decreased NF-kappaB reporter expression
- Increased transferrin (TF) endocytosis
- Increased shRNA abundance (Z-score > 2)
- Synthetic lethal with MLN4924 (a NAE inhibitor)
- Decreased focal adhesion (FA) area, decreased FA length, decreased FA mean intensity, increased number of small and round FAs, increased FA abundance
- Decreased cell migration
- Increased cell death HMECs cells
- Increased viability with MLN4924 (a NAE inhibitor)
- Increased cell migration
- Increased viability after TNF/CHX stimulation
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for PTPN6
-
-
ViGene Biosciences lentiviral particle packaged cDNA for PTPN6 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for PTPN6 gene
- Search ViGene Biosciences for PTPN6
CRISPR Products
-
OriGene CRISPR knockouts for PTPN6
- genomics-online: gRNA clones - Search results for 146 available PTPN6 gene related products
- Overview of 146 available PTPN6 gene related products
- Applied Biological Materials CRISPR for PTPN6
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for PTPN6
- GenScript: Design CRISPR guide RNA sequences for PTPN6
miRNA for PTPN6 Gene
- miRTarBase miRNAs that target PTPN6
-
- hsa-mir-1225-3p (MIRT054334)
- hsa-mir-4649-3p (MIRT733323)
- hsa-mir-186-5p (MIRT738279)
- hsa-mir-211-3p (MIRT738941)
- hsa-mir-328-5p (MIRT741296)
- hsa-mir-4270 (MIRT743590)
- hsa-mir-4441 (MIRT744557)
- hsa-mir-4447 (MIRT744659)
- hsa-mir-4472 (MIRT744985)
- hsa-mir-4525 (MIRT745923)
- hsa-mir-5010-5p (MIRT749505)
- hsa-mir-520d-5p (MIRT750231)
- hsa-mir-524-5p (MIRT750286)
- hsa-mir-6134 (MIRT752464)
- hsa-mir-6731-5p (MIRT754029)
- hsa-mir-6754-5p (MIRT754732)
- hsa-mir-6760-5p (MIRT754938)
- hsa-mir-6795-5p (MIRT756136)
- hsa-mir-6885-5p (MIRT758544)
- hsa-mir-6887-5p (MIRT758595)
- hsa-mir-7109-5p (MIRT758954)
- hsa-mir-7156-3p (MIRT759272)
- hsa-mir-8085 (MIRT760233)
- hsa-mir-92a-2-5p (MIRT760584)
miRNA Products
- Search ViGene Biosciences for PTPN6
Inhibitory RNA Products
- Origene shrna and RNAi products in human, mouse, rat for PTPN6
- Browse OriGene Inhibitory RNA Products For PTPN6
- genomics-online: shRNA clones - Search results for 146 available PTPN6 gene related products
- Overview of 146 available PTPN6 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for PTPN6 gene
Clone Products
-
OriGene ORF clones in human for PTPN6
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for PTPN6
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for PTPN6
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for PTPN6
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for PTPN6
- Applied Biological Materials Clones for PTPN6
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for PTPN6
-
ViGene Biosciences adenoviral particle packaged cDNA for PTPN6 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for PTPN6 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for PTPN6 gene
No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PTPN6 Gene
Localization for PTPN6 Gene
Subcellular locations from UniProtKB/Swiss-Prot for PTPN6 Gene
- Cytoplasm. Nucleus. Note=In neurons, translocates into the nucleus after treatment with angiotensin II (By similarity). Shuttles between the cytoplasm and nucleus via its association with PDPK1. {ECO:0000250}.
| Compartment | Confidence |
|---|---|
| extracellular | 5 |
| nucleus | 5 |
| cytosol | 5 |
| plasma membrane | 3 |
| mitochondrion | 1 |
| peroxisome | 1 |
- Nucleoli (3)
- Nucleus (3)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005576 | extracellular region | TAS | -- |
| GO:0005634 | nucleus | IEA,IDA | 19838216 |
| GO:0005730 | nucleolus | IDA | -- |
| GO:0005737 | cytoplasm | IEA,IDA | 10940933 |
| GO:0005829 | cytosol | TAS | -- |
Pathways & Interactions for PTPN6 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | RET signaling | ||
| 2 | B cell receptor signaling pathway (KEGG) | ||
| 3 | Immune response Role of DAP12 receptors in NK cells | ||
| 4 | Innate Immune System |
.61
|
|
| 5 | Immune response IFN alpha/beta signaling pathway | ||
Pathways by source for PTPN6 Gene
2 Sino Biological pathways for PTPN6 Gene
1 Cell Signaling Technology pathway for PTPN6 Gene
17 BioSystems pathways for PTPN6 Gene
7 KEGG pathways for PTPN6 Gene
10 GeneGo (Thomson Reuters) pathways for PTPN6 Gene
2 R&D Systems pathways for PTPN6 Gene
2 Qiagen pathways for PTPN6 Gene
Interacting Proteins for PTPN6 Gene
Selected Interacting proteins:
P29350-PTN6_HUMAN
ENSP00000391592
for PTPN6 Gene via
MINT
STRING
UniProtKB
IID
SIGNOR curated interactions for PTPN6 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0002244 | hematopoietic progenitor cell differentiation | IEA | -- |
| GO:0002924 | negative regulation of humoral immune response mediated by circulating immunoglobulin | IEA | -- |
| GO:0006470 | protein dephosphorylation | IDA | 11266449 |
| GO:0006915 | apoptotic process | TAS | 10506221 |
| GO:0007186 | G-protein coupled receptor signaling pathway | TAS | 7781604 |
Drugs & Compounds for PTPN6 Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| Phosphoric acid | Approved | Pharma | 0 | |||
| Water | Approved | Pharma | 0 | |||
| BVT 948 | Pharma | PTPs inhibitor,cell-permeable and non-competitve, Non-competitive protein tyrosine phosphatase inhibitor; enhances insulin signaling | 0 | |||
| NSC 87877 | Pharma | Shp2 /shp1 PTP inhibitor, Potent inhibitor of shp2 and shp1 PTP | 0 | |||
| Etidronate | Pharma | Osteoclast function modifiers (important in bone metastasis) | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs | |
|---|---|---|---|---|---|---|
| Phosphate |
|
14265-44-2 |
|
|||
| VO-OHpic |
|
675848-25-6 |
|
|
(5) Tocris Compounds for PTPN6 Gene
| Compound | Action | Cas Number |
|---|---|---|
| BVT 948 | Non-competitive protein tyrosine phosphatase inhibitor; enhances insulin signaling | 39674-97-0 |
| NSC 87877 | Potent inhibitor of shp2 and shp1 PTP | 56990-57-9 |
| Sodium orthovanadate | Protein tyrosine phosphatase inhibitor | 13721-39-6 |
| TCS 401 | Selective inhibitor of PTP1B | 243966-09-8 |
| VO-OHpic | Potent PTEN inhibitor | 675848-25-6 |
(3) ApexBio Compounds for PTPN6 Gene
| Compound | Action | Cas Number |
|---|---|---|
| BVT 948 | PTPs inhibitor,cell-permeable and non-competitve | 39674-97-0 |
| Etidronate | 2809-21-4 | |
| NSC 87877 | Shp2 /shp1 PTP inhibitor | 56990-57-9 |
Transcripts for PTPN6 Gene
mRNA/cDNA for PTPN6 Gene
- (5) REFSEQ mRNAs :
- (12) Additional mRNA sequences :
- (11) Selected AceView cDNA sequences:
- (23) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for PTPN6 Gene
CRISPR Products
-
OriGene CRISPR knockouts for PTPN6
- genomics-online: gRNA clones - Search results for 146 available PTPN6 gene related products
- Overview of 146 available PTPN6 gene related products
- Applied Biological Materials CRISPR for PTPN6
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for PTPN6
- GenScript: Design CRISPR guide RNA sequences for PTPN6
miRNA Products
- Search ViGene Biosciences for PTPN6
Inhibitory RNA Products
- Origene shrna and RNAi products in human, mouse, rat for PTPN6
- Browse OriGene Inhibitory RNA Products For PTPN6
- genomics-online: shRNA clones - Search results for 146 available PTPN6 gene related products
- Overview of 146 available PTPN6 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for PTPN6 gene
Clone Products
-
OriGene ORF clones in human for PTPN6
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for PTPN6
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for PTPN6
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for PTPN6
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for PTPN6
- Applied Biological Materials Clones for PTPN6
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1a | · | 1b | · | 1c | · | 1d | ^ | 2a | · | 2b | ^ | 3a | · | 3b | · | 3c | · | 3d | · | 3e | · | 3f | · | 3g | ^ | 4a | · | 4b | ^ | 5a | · | 5b | · | 5c | · | 5d | · | 5e | ^ | 6 | ^ | 7a | · | 7b | · | 7c | ^ | 8a | · | 8b | ^ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | - | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||
| SP2: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP4: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP5: | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||
| SP6: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP7: | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||
| SP8: | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||
| SP9: | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP10: | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||
| SP11: | - | - | - | - | - | - | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||
| SP12: | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP13: | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||
| SP14: | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||
| SP15: | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP16: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP17: | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||
| SP18: | - | - | - | - | - | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||
| SP19: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP20: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP21: |
| ExUns: | 9a | · | 9b | ^ | 10 | ^ | 11 | ^ | 12 | ^ | 13 | ^ | 14 | ^ | 15 | ^ | 16 | ^ | 17a | · | 17b | ^ | 18 | ^ | 19a | · | 19b | ^ | 20a | · | 20b | ^ | 21a | · | 21b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | ||||||||||||||||||||||||||||||||
| SP2: | - | - | - | ||||||||||||||||||||||||||||||||
| SP3: | - | - | |||||||||||||||||||||||||||||||||
| SP4: | |||||||||||||||||||||||||||||||||||
| SP5: | |||||||||||||||||||||||||||||||||||
| SP6: | - | - | |||||||||||||||||||||||||||||||||
| SP7: | |||||||||||||||||||||||||||||||||||
| SP8: | |||||||||||||||||||||||||||||||||||
| SP9: | |||||||||||||||||||||||||||||||||||
| SP10: | |||||||||||||||||||||||||||||||||||
| SP11: | |||||||||||||||||||||||||||||||||||
| SP12: | |||||||||||||||||||||||||||||||||||
| SP13: | |||||||||||||||||||||||||||||||||||
| SP14: | |||||||||||||||||||||||||||||||||||
| SP15: | |||||||||||||||||||||||||||||||||||
| SP16: | |||||||||||||||||||||||||||||||||||
| SP17: | |||||||||||||||||||||||||||||||||||
| SP18: | |||||||||||||||||||||||||||||||||||
| SP19: | |||||||||||||||||||||||||||||||||||
| SP20: | |||||||||||||||||||||||||||||||||||
| SP21: |
Expression for PTPN6 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Hair (Integumentary System)
- Bulge Stem Cells Bulge
-
Placenta (Extraembryonic Tissues)
- Primordial Germ Cells Allantois
-
Gonad
- Primordial Germ Cells Allantois
-
Blood (Hematopoietic System)
- Hematopoietic Stem Cells Hematopoietic Bone Marrow
- Bone (Muscoskeletal System)
-
Spleen (Hematopoietic System)
mRNA differential expression in normal tissues according to GTEx for PTPN6 Gene
This gene is overexpressed in Whole Blood (x21.6) and Spleen (x5.7).
This gene is overexpressed in Peripheral blood mononuclear cells (17.0), Lymph node (10.7), Blymphocyte (8.6), and Monocytes (7.4).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PTPN6 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of PTPN6 Gene:
PTPN6SOURCE GeneReport for Unigene cluster for PTPN6 Gene:
Hs.63489mRNA Expression by UniProt/SwissProt for PTPN6 Gene:
P29350-PTN6_HUMAN
Tissue specificity:
Isoform 1 is expressed in hematopoietic cells. Isoform 2 is expressed in non-hematopoietic cells.
Evidence on tissue expression from TISSUES for PTPN6 Gene
- Blood(4.8)
- Spleen(3.8)
- Lung(2.8)
- Bone marrow(2.4)
- Lymph node(2.1)
Primer Products
-
OriGene qPCR primer pairs for PTPN6
-
OriGene qPCR primer pairs and template standards for PTPN6
- genomics-online: primer clones - Search results for 146 available PTPN6 gene related products
- Overview of 146 available PTPN6 gene related products
No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for PTPN6 Gene
Orthologs for PTPN6 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | PTPN6 33 34 |
|
||
| cow (Bos Taurus) |
Mammalia | PTPN6 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | PTPN6 33 34 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | PTPN6 34 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Ptpn6 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Ptpn6 33 16 34 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | PTPN6 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | PTPN6 33 34 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | PTPN6 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | ptpn6 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | ptpn6 33 34 |
|
||
| -- 33 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.10340 33 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | csw 34 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | ptp-2 35 34 |
|
||
| F47B3.1 35 |
|
|
|||
| F47B3.6 35 |
|
|
|||
| F47B3.7 35 |
|
|
|||
| Y48G9A.9 35 |
|
|
|||
| C55B7.3 35 |
|
|
|||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToMany |
- Species where no ortholog for PTPN6 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for PTPN6 Gene
Paralogs for PTPN6 Gene
(6) SIMAP similar genes for PTPN6 Gene using alignment to 10 proteins:
Variants for PTPN6 Gene
| SNP ID | Clin | Chr 12 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs139068225 | uncertain-significance, not specified, Temtamy syndrome | 6,945,798(+) | A/G | upstream_transcript_variant | |
| rs199730337 | likely-benign, benign, not specified, Temtamy syndrome | 6,944,655(+) | GGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGG/GGGTCAGACGCGGGAAGGCGGG/GGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGG | upstream_transcript_variant | |
| rs587777698 | pathogenic, likely-pathogenic, Temtamy syndrome, not provided | 6,944,607(+) | C/T | upstream_transcript_variant | |
| rs868941218 | pathogenic, Temtamy syndrome | 6,944,575(+) | T/A | ||
| rs781825705 | uncertain-significance, not specified | 6,945,781(+) | G/A | upstream_transcript_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv952791 | CNV | deletion | 24416366 |
| nsv557262 | CNV | gain | 21841781 |
| nsv513351 | CNV | insertion | 21212237 |
| nsv509453 | CNV | insertion | 20534489 |
| nsv1047373 | CNV | gain | 25217958 |
| nsv1035811 | CNV | gain | 25217958 |
| esv994245 | CNV | insertion | 20482838 |
| esv3381477 | CNV | insertion | 20981092 |
| esv3356433 | CNV | duplication | 20981092 |
| dgv2326n54 | CNV | loss | 21841781 |
| dgv2325n54 | CNV | loss | 21841781 |
| dgv2324n54 | CNV | loss | 21841781 |
Residual Variation Intolerance Score:
13.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
1.15;
23.27% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for PTPN6 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PTPN6 Gene
Disorders for PTPN6 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| cd45 deficiency |
|
|
Search PTPN6 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for PTPN6
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for PTPN6 Gene
Publications for PTPN6 Gene
- The nuclear localization of 3'-phosphoinositide-dependent kinase-1 is dependent on its association with the protein tyrosine phosphatase SHP-1. (PMID: 19591923) Sephton CF … Mousseau DD (Cellular signalling 2009) 3 4 22 58
- Crystal structure of human protein-tyrosine phosphatase SHP-1. (PMID: 12482860) Yang J … Zhou GW (The Journal of biological chemistry 2003) 3 4 22 58
- Functional interaction between SHPTP1 and the Lyn tyrosine kinase in the apoptotic response to DNA damage. (PMID: 10574931) Yoshida K … Kufe D (The Journal of biological chemistry 1999) 3 4 22 58
- Human 70-kDa SHP-1L differs from 68-kDa SHP-1 in its C-terminal structure and catalytic activity. (PMID: 10497187) Jin YJ … Burakoff SJ (The Journal of biological chemistry 1999) 3 4 22 58
- Tyrosine phosphorylation of an SH2-containing protein tyrosine phosphatase is coupled to platelet thrombin receptor via a pertussis toxin-sensitive heterotrimeric G-protein. (PMID: 7781604) Li RY … Chap H (The EMBO journal 1995) 3 4 22 58
Products for PTPN6 Gene
- R&D Systems Antibodies for PTPN6 (SHP-1)
- R&D Systems Proteins and Enzymes for PTPN6 (SHP-1)
- R&D Systems Proteome Profiler Antibody Arrays and other biochemical assays for PTPN6 (SHP-1)
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for PTPN6
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for MassSpec and Protein Over-expression Lysates for PTPN6
- Origene Custom Protein Services for PTPN6
- Origene shrna and RNAi products in human, mouse, rat for PTPN6
- Browse OriGene Inhibitory RNA Products For PTPN6
- OriGene qPCR primer pairs and template standards for PTPN6
- OriGene qPCR primer pairs for PTPN6
- OriGene CRISPR knockouts for PTPN6
- OriGene ORF clones in human for PTPN6
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For PTPN6
- GenScript: Next-day shipping of latest version cDNA ORF clones for PTPN6 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for PTPN6
- GenScript Custom Assay Services for PTPN6
- GenScript Custom overexpressing Cell Line Services for PTPN6
- GenScript: Design CRISPR guide RNA sequences for PTPN6
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for PTPN6
- Cell Signaling Technology (CST) Antibodies for PTPN6 (SHP-1)
- Search for Antibodies & Assays
- Sino Biological Human cDNA Clone for PTPN6
- Sino Biological Cell Lysates for PTPN6
- Sino Biological Recombinant Proteins for PTPN6
- Sino Biological Antibodies for PTPN6
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for PTPN6
- Novus Biologicals lysates and proteins for PTPN6
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for PTPN6
- Abcam proteins for PTPN6
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- ProSpec Recombinant Proteins for PTPN6
- Cloud-Clone Corp. Antibodies for PTPN6
- Cloud-Clone Corp. Proteins for PTPN6
- Cloud-Clone Corp. Assay Kits for PTPN6
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for PTPN6
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- ApexBio compounds for PTPN6
- Cyagen custom Knockout/knockin (KOKI) mouse models for PTPN6
- VectorBuilder custom plasmid, inducible vectors for PTPN6
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for PTPN6
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for PTPN6
- antibodies-online: Search results for 206 available PTPN6 Antibodies ranked by validation data
- Compare Top PTPN6 Antibodies
- Recommended
- 53 WB Antibodies (anti-mouse)
- 24 IF (p) Antibodies (anti-mouse)
- 10 IHC Antibodies (anti-mouse)
- 2 IHC (p) Antibodies (anti-mouse)
- 148 WB Antibodies (anti-human)
- 26 IF (p) Antibodies (anti-human)
- 15 IHC Antibodies (anti-human)
- 3 IHC (p) Antibodies (anti-human)
- 2 RIA Antibodies (anti-human)
- 1 FACS Antibody (anti-human)
- 1 IF/ICC Antibody (anti-human)
- 50 WB Antibodies (anti-rat)
- 24 IF (p) Antibodies (anti-rat)
- 8 IHC Antibodies (anti-rat)
- 2 IHC (p) Antibodies (anti-rat)
- antibodies-online: Search results for 15 available PTPN6 Elisa Kits ranked by validation data
- Compare Top PTPN6 Elisa Kits
- antibodies-online: Search results for 20 available PTPN6 Proteins ranked by validation data
- Compare Top PTPN6 Proteins
- GeneTex PTPN6 antibody for PTPN6
- Search GeneTex for Proteins for PTPN6
- ViGene Biosciences adenoviral particle packaged cDNA for PTPN6 gene
- ViGene Biosciences lentiviral particle packaged cDNA for PTPN6 gene
- ViGene Biosciences ready-to-package AAV shRNAs for PTPN6 gene
- Search ViGene Biosciences for PTPN6
- Santa Cruz Biotechnology (SCBT) Antibodies for PTPN6
- Search Santa Cruz Biotechnology (SCBT) for PTPN6 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for PTPN6