This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosp... See more...

Aliases for PTEN Gene

Aliases for PTEN Gene

  • Phosphatase And Tensin Homolog 2 3 4 5
  • Mutated In Multiple Advanced Cancers 1 2 3 4
  • Phosphatidylinositol 3,4,5-Trisphosphate 3-Phosphatase And Dual-Specificity Protein Phosphatase PTEN 3 4
  • MMAC1 3 4
  • TEP1 3 4
  • Phosphatidylinositol-3,4,5-Trisphosphate 3-Phosphatase And Dual-Specificity Protein Phosphatase PTEN 3
  • MMAC1 Phosphatase And Tensin Homolog Deleted On Chromosome 10 3
  • Mitochondrial Phosphatase And Tensin Protein Alpha 3
  • Phosphatase And Tensin-Like Protein 3
  • Protein Tyrosine Phosphatase 3
  • Mitochondrial PTENalpha 3
  • EC 4
  • EC 4
  • EC 4
  • 10q23del 3
  • PTENbeta 3
  • PTEN1 3
  • CWS1 3
  • GLM2 3
  • MHAM 3
  • DEC 3
  • BZS 3

External Ids for PTEN Gene

Previous HGNC Symbols for PTEN Gene

  • BZS
  • MHAM

Previous GeneCards Identifiers for PTEN Gene

  • GC10P088504
  • GC10P088844
  • GC10P089754
  • GC10P089287
  • GC10P089613
  • GC10P083258

Summaries for PTEN Gene

Entrez Gene Summary for PTEN Gene

  • This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]

CIViC Summary for PTEN Gene

  • PTEN is a multi-functional tumor suppressor that is very commonly lost in human cancer. Observed in prostate cancer, glioblastoma, endometrial, lung and breast cancer to varying degrees. Up to 70% of prostate cancer patients have been observed to have loss of expression of the gene. It is a part of the PI3K/AKT/mTOR pathway and mTOR inhibitors have been relatively ineffective in treating patients with PTEN loss. New appoaches using microRNAs are currently being investigated.

GeneCards Summary for PTEN Gene

PTEN (Phosphatase And Tensin Homolog) is a Protein Coding gene. Diseases associated with PTEN include Cowden Syndrome 1 and Macrocephaly/Autism Syndrome. Among its related pathways are PI3K/AKT activation and TCR signaling (REACTOME). Gene Ontology (GO) annotations related to this gene include protein kinase binding and magnesium ion binding. An important paralog of this gene is TPTE2.

UniProtKB/Swiss-Prot Summary for PTEN Gene

  • Tumor suppressor. Acts as a dual-specificity protein phosphatase, dephosphorylating tyrosine-, serine- and threonine-phosphorylated proteins. Also acts as a lipid phosphatase, removing the phosphate in the D3 position of the inositol ring from phosphatidylinositol 3,4,5-trisphosphate, phosphatidylinositol 3,4-diphosphate, phosphatidylinositol 3-phosphate and inositol 1,3,4,5-tetrakisphosphate with order of substrate preference in vitro PtdIns(3,4,5)P3 > PtdIns(3,4)P2 > PtdIns3P > Ins(1,3,4,5)P4 (PubMed:26504226, PubMed:16824732). The lipid phosphatase activity is critical for its tumor suppressor function. Antagonizes the PI3K-AKT/PKB signaling pathway by dephosphorylating phosphoinositides and thereby modulating cell cycle progression and cell survival. The unphosphorylated form cooperates with AIP1 to suppress AKT1 activation. Dephosphorylates tyrosine-phosphorylated focal adhesion kinase and inhibits cell migration and integrin-mediated cell spreading and focal adhesion formation. Plays a role as a key modulator of the AKT-mTOR signaling pathway controlling the tempo of the process of newborn neurons integration during adult neurogenesis, including correct neuron positioning, dendritic development and synapse formation. May be a negative regulator of insulin signaling and glucose metabolism in adipose tissue. The nuclear monoubiquitinated form possesses greater apoptotic potential, whereas the cytoplasmic nonubiquitinated form induces less tumor suppressive ability. In motile cells, suppresses the formation of lateral pseudopods and thereby promotes cell polarization and directed movement.
  • Isoform alpha: Functional kinase, like isoform 1 it antagonizes the PI3K-AKT/PKB signaling pathway. Plays a role in mitochondrial energetic metabolism by promoting COX activity and ATP production, via collaboration with isoform 1 in increasing protein levels of PINK1.

Gene Wiki entry for PTEN Gene

Additional gene information for PTEN Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PTEN Gene

Genomics for PTEN Gene

GeneHancer (GH) Regulatory Elements for PTEN Gene

Promoters and enhancers for PTEN Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH10J087860 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 755.9 +2.6 2585 11.6 ZNF785 SIN3A ZNF24 SP1 ZBTB40 CTCF LCORL ZBTB6 MLX RBPJ PTEN lnc-KLLN-2 NUTM2A-AS1 SHLD2 RPL11P3 LIPJ CFL1P1 NUTM2A ADIRF-AS1 KLLN
GH10J087815 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 750.2 -46.1 -46073 4.5 ZBTB40 CTCF POLR2A HCFC1 ZNF362 MYC ETV6 HLF L3MBTL2 MAX CFL1P1 lnc-PTEN-12 PTEN ATAD1 piR-59012-001
GH10J088058 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 32.3 +201.9 201863 15.4 ZNF24 SP1 FOXA1 JUND MYC ETV6 RELA MAX RAD21 ZNF148 PTEN KLLN SHLD2 ACTA2 ACTA2-AS1 MINPP1 FAS NUTM2D MED6P1 lnc-KLLN-4
GH10J087915 Enhancer 1.2 Ensembl ENCODE dbSUPER 17.8 +60.4 60363 18.8 ZBTB6 CC2D1A HLF NFIB MAFK ZSCAN21 PRDM1 IKZF1 PKNOX1 POLR2A NONHSAG006457.2 lnc-PAPSS2-7 PTEN KLLN STAMBPL1 LIPJ piR-48222-049
GH10J088383 Enhancer 1.4 FANTOM5 ENCODE CraniofacialAtlas dbSUPER 11.9 +523.7 523669 7.4 SP1 CTCF ZNF362 MYC NFYC ETV6 RELA RAD21 POLR2A MLLT1 KLLN PTEN LIPK piR-57461-026 HSALNG0079525 RNLS
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PTEN on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PTEN gene promoter:
  • ATF-2
  • CREB
  • deltaCREB
  • FOXO1
  • FOXO1a
  • Lmo2
  • Nkx2-5
  • PPAR-gamma1
  • PPAR-gamma2
  • STAT3

Genomic Locations for PTEN Gene

Genomic Locations for PTEN Gene
108,493 bases
Plus strand
108,818 bases
Plus strand

Genomic View for PTEN Gene

Genes around PTEN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PTEN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PTEN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PTEN Gene

Proteins for PTEN Gene

  • Protein details for PTEN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN
    Protein Accession:
    Secondary Accessions:
    • B2R904
    • F2YHV0
    • O00633
    • O02679
    • Q6ICT7

    Protein attributes for PTEN Gene

    403 amino acids
    Molecular mass:
    47166 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Monomer. The unphosphorylated form interacts with the second PDZ domain of AIP1 and with DLG1 and MAST2 in vitro (PubMed:10646847, PubMed:10760291, PubMed:11707428). Interacts with MAGI2, MAGI3, MAST1 and MAST3, but neither with MAST4 nor with DLG5; interaction with MAGI2 increases protein stability (PubMed:10748157, PubMed:15951562). Interacts with NEDD4 (PubMed:17218260). Interacts with NDFIP1 and NDFIP2; in the presence of NEDD4 or ITCH, this interaction promotes PTEN ubiquitination (PubMed:25801959, PubMed:20534535). Interacts (via C2 domain) with FRK (PubMed:19345329). Interacts with USP7; the interaction is direct (PubMed:18716620). Interacts with ROCK1 (By similarity). Interacts with XIAP/BIRC4 (PubMed:19473982). Interacts with STK11; the interaction phosphorylates PTEN (PubMed:15987703). Interacts with PPP1R16B (PubMed:25007873). Interacts with NOP53; regulates PTEN phosphorylation and increases its stability (PubMed:15355975).

    Three dimensional structures from OCA and Proteopedia for PTEN Gene

    Alternative splice isoforms for PTEN Gene


neXtProt entry for PTEN Gene

Post-translational modifications for PTEN Gene

  • Constitutively phosphorylated by CK2 under normal conditions. Phosphorylated in vitro by MAST1, MAST2, MAST3 and STK11. Phosphorylation results in an inhibited activity towards PIP3. Phosphorylation can both inhibit or promote PDZ-binding. Phosphorylation at Tyr-336 by FRK/PTK5 protects this protein from ubiquitin-mediated degradation probably by inhibiting its binding to NEDD4. Phosphorylation by ROCK1 is essential for its stability and activity. Phosphorylation by PLK3 promotes its stability and prevents its degradation by the proteasome.
  • Monoubiquitinated; monoubiquitination is increased in presence of retinoic acid. Deubiquitinated by USP7; leading to its nuclear exclusion. Monoubiquitination of one of either Lys-13 and Lys-289 amino acid is sufficient to modulate PTEN compartmentalization. Ubiquitinated by XIAP/BIRC4.
  • Ubiquitination at Lys13, Lys80, and Lys289
  • Modification sites at PhosphoSitePlus

Other Protein References for PTEN Gene

No data available for DME Specific Peptides for PTEN Gene

Domains & Families for PTEN Gene

Gene Families for PTEN Gene

Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for PTEN Gene

GenScript: Design optimal peptide antigens:
  • PTEN splice variant (F2YHV0_HUMAN)
  • Phosphatase and tensin homolog (PTEN_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • The C2 domain binds phospholipid membranes in vitro in a Ca(2+)-independent manner; this binding is important for its tumor suppressor function.
  • Belongs to the PTEN phosphatase protein family.
  • The C2 domain binds phospholipid membranes in vitro in a Ca(2+)-independent manner; this binding is important for its tumor suppressor function.
  • Belongs to the PTEN phosphatase protein family.
genes like me logo Genes that share domains with PTEN: view

Function for PTEN Gene

Molecular function for PTEN Gene

UniProtKB/Swiss-Prot Function:
Tumor suppressor. Acts as a dual-specificity protein phosphatase, dephosphorylating tyrosine-, serine- and threonine-phosphorylated proteins. Also acts as a lipid phosphatase, removing the phosphate in the D3 position of the inositol ring from phosphatidylinositol 3,4,5-trisphosphate, phosphatidylinositol 3,4-diphosphate, phosphatidylinositol 3-phosphate and inositol 1,3,4,5-tetrakisphosphate with order of substrate preference in vitro PtdIns(3,4,5)P3 > PtdIns(3,4)P2 > PtdIns3P > Ins(1,3,4,5)P4 (PubMed:26504226, PubMed:16824732). The lipid phosphatase activity is critical for its tumor suppressor function. Antagonizes the PI3K-AKT/PKB signaling pathway by dephosphorylating phosphoinositides and thereby modulating cell cycle progression and cell survival. The unphosphorylated form cooperates with AIP1 to suppress AKT1 activation. Dephosphorylates tyrosine-phosphorylated focal adhesion kinase and inhibits cell migration and integrin-mediated cell spreading and focal adhesion formation. Plays a role as a key modulator of the AKT-mTOR signaling pathway controlling the tempo of the process of newborn neurons integration during adult neurogenesis, including correct neuron positioning, dendritic development and synapse formation. May be a negative regulator of insulin signaling and glucose metabolism in adipose tissue. The nuclear monoubiquitinated form possesses greater apoptotic potential, whereas the cytoplasmic nonubiquitinated form induces less tumor suppressive ability. In motile cells, suppresses the formation of lateral pseudopods and thereby promotes cell polarization and directed movement.
UniProtKB/Swiss-Prot Function:
Isoform alpha: Functional kinase, like isoform 1 it antagonizes the PI3K-AKT/PKB signaling pathway. Plays a role in mitochondrial energetic metabolism by promoting COX activity and ATP production, via collaboration with isoform 1 in increasing protein levels of PINK1.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=a 1,2-diacyl-sn-glycero-3-phospho-(1D-myo-inositol-3,4,5-trisphosphate) + H2O = a 1,2-diacyl-sn-glycero-3-phospho-(1D-myo-inositol-4,5-bisphosphate) + phosphate; Xref=Rhea:RHEA:25017, ChEBI:CHEBI:15377, ChEBI:CHEBI:43474, ChEBI:CHEBI:57836, ChEBI:CHEBI:58456; EC=; Evidence={ECO:0000269 PubMed:16824732, ECO:0000269 PubMed:9593664, ECO:0000269 PubMed:9811831};.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=H2O + O-phospho-L-seryl-[protein] = L-seryl-[protein] + phosphate; Xref=Rhea:RHEA:20629, Rhea:RHEA-COMP:9863, Rhea:RHEA-COMP:11604, ChEBI:CHEBI:15377, ChEBI:CHEBI:29999, ChEBI:CHEBI:43474, ChEBI:CHEBI:83421; EC=; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=H2O + O-phospho-L-threonyl-[protein] = L-threonyl-[protein] + phosphate; Xref=Rhea:RHEA:47004, Rhea:RHEA-COMP:11060, Rhea:RHEA-COMP:11605, ChEBI:CHEBI:15377, ChEBI:CHEBI:30013, ChEBI:CHEBI:43474, ChEBI:CHEBI:61977; EC=; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=H2O + O-phospho-L-tyrosyl-[protein] = L-tyrosyl-[protein] + phosphate; Xref=Rhea:RHEA:10684, Rhea:RHEA-COMP:10136, Rhea:RHEA-COMP:10137, ChEBI:CHEBI:15377, ChEBI:CHEBI:43474, ChEBI:CHEBI:46858, ChEBI:CHEBI:82620; EC=; Evidence={ECO:0000269 PubMed:9187108, ECO:0000269 PubMed:9256433};.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=1,2-dioctanoyl-sn-glycero-3-phospho-(1D-myo-inositol-3,4,5-trisphosphate) + H2O = 1,2-dioctanoyl-sn-glycero-3-phospho-(1D-myo-inositol-4,5-bisphosphate) + phosphate; Xref=Rhea:RHEA:43552, ChEBI:CHEBI:15377, ChEBI:CHEBI:43474, ChEBI:CHEBI:83416, ChEBI:CHEBI:83419; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:43553; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=1,2-dihexadecanoyl-sn-glycero-3-phospho-(1D-myo-inositol-3,4,5-trisphosphate) + H2O = 1,2-dihexadecanoyl-sn-glycero-3-phospho-(1D-myo-inositol-4,5-bisphosphate) + phosphate; Xref=Rhea:RHEA:43560, ChEBI:CHEBI:15377, ChEBI:CHEBI:43474, ChEBI:CHEBI:83420, ChEBI:CHEBI:83423; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:43561; Evidence=. ;.
UniProtKB/Swiss-Prot EnzymeRegulation:
Enzymatic activity is enhanced in the presence of phosphatidylserine.
UniProtKB/Swiss-Prot Induction:
Down-regulated by TGFB1.
GENATLAS Biochemistry:
phosphatase and tensin homolog,antagonizing signal transduction downstream of PI-3 kinase by dephosphorylating phosphatidylinositol-phosphate (PtdInsP),expressed in normal colon,tumor suppressor gene,modulating cell cycle progression and cell survival,negative regulator of cell interactions with the extracellular matrix,mutated in multiple advanced cancers (prostate and colorectal carcinoma,primary glioblastoma,renal cell carcinoma,breast and brain cancer,small cell lung cancer,squamous cell carcinoma of head and neck,sporadic follicular thyroid tumor,Cowden syndrome,melanoma and Bannayan Zonana syndrome,endometrial atypical hyperplasia,high grade astrocytoma,lymphoid neoplasms,laryngeal tumors),inversely correlated with AKF1

Enzyme Numbers (IUBMB) for PTEN Gene

Phenotypes From GWAS Catalog for PTEN Gene

Gene Ontology (GO) - Molecular Function for PTEN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004438 phosphatidylinositol-3-phosphatase activity IDA,IEA 9811831
GO:0004721 phosphoprotein phosphatase activity IDA 21241890
GO:0004722 protein serine/threonine phosphatase activity IDA 9256433
GO:0004725 protein tyrosine phosphatase activity IDA 9256433
GO:0005161 platelet-derived growth factor receptor binding IEA --
genes like me logo Genes that share ontologies with PTEN: view

Phenotypes for PTEN Gene

MGI mutant phenotypes for PTEN:
inferred from 19 alleles
GenomeRNAi human phenotypes for PTEN:
genes like me logo Genes that share phenotypes with PTEN: view

Human Phenotype Ontology for PTEN Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for PTEN Gene

MGI Knock Outs for PTEN:

Animal Model Products

CRISPR Products

miRNA for PTEN Gene

miRTarBase miRNAs that target PTEN

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PTEN

Clone Products

  • Addgene plasmids for PTEN

No data available for Transcription Factor Targets and HOMER Transcription for PTEN Gene

Localization for PTEN Gene

Subcellular locations from UniProtKB/Swiss-Prot for PTEN Gene

Cytoplasm. Nucleus. Nucleus, PML body. Note=Monoubiquitinated form is nuclear. Nonubiquitinated form is cytoplasmic. Colocalized with PML and USP7 in PML nuclear bodies (PubMed:18716620). XIAP/BIRC4 promotes its nuclear localization (PubMed:19473982). {ECO:0000269 PubMed:18716620, ECO:0000269 PubMed:19473982}.
Isoform alpha: Secreted. Note=May be secreted via a classical signal peptide and reenter into cells with the help of a poly-Arg motif.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PTEN gene
Compartment Confidence
plasma membrane 5
nucleus 5
cytosol 5
extracellular 4
mitochondrion 3
cytoskeleton 2
peroxisome 1
endoplasmic reticulum 1
endosome 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PTEN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005634 nucleus IDA,IEA 17218261
GO:0005654 nucleoplasm TAS --
GO:0005737 cytoplasm TAS 9367992
GO:0005739 mitochondrion IEA --
genes like me logo Genes that share ontologies with PTEN: view

Pathways & Interactions for PTEN Gene

genes like me logo Genes that share pathways with PTEN: view

Pathways by source for PTEN Gene

SIGNOR curated interactions for PTEN Gene

Is activated by:
Is inactivated by:
Other effect:

Gene Ontology (GO) - Biological Process for PTEN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000079 regulation of cyclin-dependent protein serine/threonine kinase activity TAS 10918569
GO:0001525 angiogenesis IEA --
GO:0001933 negative regulation of protein phosphorylation ISS --
GO:0002902 regulation of B cell apoptotic process IEA --
GO:0006367 transcription initiation from RNA polymerase II promoter TAS --
genes like me logo Genes that share ontologies with PTEN: view

Drugs & Compounds for PTEN Gene

(106) Drugs for PTEN Gene - From: DrugBank, PharmGKB, ClinicalTrials, ApexBio, DGIdb, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Cetuximab Approved Pharma Antibody, Biomarker, inhibitor EGFR Inhibitors, Therapeutic Antibodies, Epidermal growth factor receptor (EGFR) inhibitors 846
Everolimus Approved Pharma inhibitor, Biomarker mTOR inhibitor, mTOR Inhibitors, Kinase Inhibitors, Mammalian target of rapamycin (mTOR) inhibitors 1923
Cisplatin Approved Pharma Inhibits DNA synthesis,chemotherapy drug, Potent pro-apoptotic anticancer agent; activates caspase-3, Platinum 3240
Erlotinib Approved, Investigational Pharma Inhibition, inhibitor, Biomarker EGFR tyrosine kinase inhibitor, EGFR inhibitor, EGFR Inhibitors, Kinase Inhibitors, Epidermal growth factor receptor (EGFR) inhibitors 0
Gefitinib Approved, Investigational Pharma Biomarker, inhibitor EGFR Inhibitors, Kinase Inhibitors, Epidermal growth factor receptor (EGFR) inhibitors 397

(420) Additional Compounds for PTEN Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 1,2-Diacyl-sn-glycero-3-phospho-(1'-myo-inositol-3',4',5'-bisphosphate)
  • 1-Phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate
  • (3-Phosphatidyl)-1-D-inositol
  • 1,2-Diacyl-sn-glycero-3-phosphoinositol
  • 1-Phosphatidyl-1D-myo-inositol
  • 1-Phosphatidyl-myo-inositol
  • Phosphatidyl-1D-myo-inositol
  • [po(OH)3]
  • Acide phosphorique
  • Acidum phosphoricum
  • H3PO4
  • Orthophosphoric acid
14066-19-4, 14265-44-2
  • 1,2-Dihexadecanoyl-rac-glycero-3-phospho-(1'-myo-inositol)
  • 1,2-Dipalmitoyl-rac-glycero-3-phosphoinositol
  • Phosphatidylinositol(16:0/16:0)
  • Phosphatidylinositol(32:0)
  • PI(32:0)
  • 1-Hexadecanoyl-2-(9Z-hexadecenoyl)-sn-glycero-3-phospho-(1'-myo-inositol)
  • 1-Palmitoyl-2-palmitoleoyl-sn-glycero-3-phosphoinositol
  • Phosphatidylinositol(16:0/16:1)
  • Phosphatidylinositol(16:0/16:1n7)
  • Phosphatidylinositol(16:0/16:1W7)

(2) ApexBio Compounds for PTEN Gene

Compound Action Cas Number
SF1670 PTEN inhibitor, potent and specific 345630-40-2
VO-Ohpic trihydrate PTEN inhibitor 476310-60-8
genes like me logo Genes that share compounds with PTEN: view

Drug Products

Transcripts for PTEN Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PTEN

Clone Products

  • Addgene plasmids for PTEN

Alternative Splicing Database (ASD) splice patterns (SP) for PTEN Gene

No ASD Table

Relevant External Links for PTEN Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PTEN Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PTEN Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for PTEN Gene

This gene is overexpressed in Whole Blood (x5.0).

Protein differential expression in normal tissues from HIPED for PTEN Gene

This gene is overexpressed in Adrenal (17.6), Peripheral blood mononuclear cells (7.3), and Fetal Brain (6.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PTEN Gene

Protein tissue co-expression partners for PTEN Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PTEN Gene:


SOURCE GeneReport for Unigene cluster for PTEN Gene:


mRNA Expression by UniProt/SwissProt for PTEN Gene:

Tissue specificity: Expressed at a relatively high level in all adult tissues, including heart, brain, placenta, lung, liver, muscle, kidney and pancreas.

Evidence on tissue expression from TISSUES for PTEN Gene

  • Lung(4.7)
  • Liver(4.6)
  • Spleen(4.5)
  • Nervous system(3.8)
  • Intestine(3.3)
  • Blood(3)
  • Thyroid gland(2.9)
  • Lymph node(2.8)
  • Muscle(2.8)
  • Heart(2.7)
  • Skin(2.6)
  • Kidney(2.5)
  • Pancreas(2.5)
  • Stomach(2.4)
  • Bone marrow(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for PTEN Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • hypothalamus
  • jaw
  • lip
  • mandible
  • maxilla
  • meninges
  • mouth
  • neck
  • nose
  • parathyroid
  • pituitary gland
  • salivary gland
  • skull
  • thyroid
  • tongue
  • tooth
  • breast
  • bronchus
  • chest wall
  • clavicle
  • esophagus
  • heart
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • adrenal gland
  • appendix
  • duodenum
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • spleen
  • stomach
  • anus
  • ovary
  • pelvis
  • penis
  • rectum
  • testicle
  • ureter
  • urethra
  • urinary bladder
  • uterus
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • coagulation system
  • hair
  • lymph node
  • lymph vessel
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • spinal cord
  • sweat gland
  • vertebrae
genes like me logo Genes that share expression patterns with PTEN: view

Orthologs for PTEN Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PTEN Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PTEN 33 32
  • 99.83 (n)
(Bos Taurus)
Mammalia PTEN 33 32
  • 98.1 (n)
(Canis familiaris)
Mammalia PTEN 33 32
  • 96.69 (n)
(Mus musculus)
Mammalia Pten 17 33 32
  • 96.2 (n)
(Rattus norvegicus)
Mammalia Pten 32
  • 95.53 (n)
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 81 (a)
-- 33
  • 74 (a)
(Monodelphis domestica)
Mammalia PTEN 33
  • 80 (a)
(Gallus gallus)
Aves PTEN 33 32
  • 91.29 (n)
(Anolis carolinensis)
Reptilia PTEN 33
  • 94 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia pten 32
  • 82.38 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.561 32
(Danio rerio)
Actinopterygii ptenb 33 32
  • 79.2 (n)
ptena 33
  • 76 (a)
pten 32
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.12284 32
fruit fly
(Drosophila melanogaster)
Insecta Pten 33 34 32
  • 54.6 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP009628 32
  • 53.07 (n)
(Caenorhabditis elegans)
Secernentea daf-18 33 34
  • 15 (a)
(Hordeum vulgare)
Liliopsida Hv.1456 32
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 64 (a)
Cin.3243 32
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.3243 32
Species where no ortholog for PTEN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PTEN Gene

Gene Tree for PTEN (if available)
Gene Tree for PTEN (if available)
Evolutionary constrained regions (ECRs) for PTEN: view image

Paralogs for PTEN Gene

Paralogs for PTEN Gene

(8) SIMAP similar genes for PTEN Gene using alignment to 5 proteins:

  • H6WA46_HUMAN
  • H6WA51_HUMAN
  • H6WA52_HUMAN
genes like me logo Genes that share paralogs with PTEN: view

Variants for PTEN Gene

Sequence variations from dbSNP and Humsavar for PTEN Gene

SNP ID Clin Chr 10 pos Variation AA Info Type
rs1006891299 uncertain-significance, likely-benign, not specified, not provided, Hereditary cancer-predisposing syndrome 87,965,477(+) T/C 3_prime_UTR_variant
rs1009588340 likely-benign, not specified, PTEN hamartoma tumor syndrome 87,957,847(+) A/G intron_variant
rs1028746954 likely-benign, Cowden syndrome 1 87,960,840(+) ATTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT/ intron_variant
rs1043121029 uncertain-significance, Cowden syndrome 1 87,952,066(+) A/G intron_variant
rs1044322 benign, uncertain-significance, not specified, PTEN hamartoma tumor syndrome, not provided 87,863,566(+) G/A/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for PTEN Gene

Variant ID Type Subtype PubMed ID
dgv1333n54 CNV loss 21841781
esv25064 CNV gain 19812545
esv2530664 CNV deletion 19546169
esv2678342 CNV deletion 23128226
esv275087 CNV gain+loss 21479260
esv3546637 CNV deletion 23714750
esv3579049 CNV loss 25503493
esv3624116 CNV loss 21293372
nsv1035154 CNV gain 25217958
nsv1035278 CNV gain 25217958
nsv1041392 CNV gain 25217958
nsv1044043 CNV gain 25217958
nsv1044700 CNV gain 25217958
nsv1050406 CNV gain 25217958
nsv1069065 CNV deletion 25765185
nsv1121819 CNV deletion 24896259
nsv551832 CNV loss 21841781
nsv551837 CNV loss 21841781
nsv820703 CNV deletion 20802225
nsv948128 CNV duplication 23825009

Variation tolerance for PTEN Gene

Residual Variation Intolerance Score: 39.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.13; 2.99% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PTEN Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PTEN Gene

Disorders for PTEN Gene

MalaCards: The human disease database

(157) MalaCards diseases for PTEN Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
cowden syndrome 1
  • cws1
macrocephaly/autism syndrome
  • macrocephaly-autism syndrome
glioma susceptibility 2
  • glm2
prostate cancer
  • prostate cancer, somatic
cowden syndrome
  • cs
- elite association - COSMIC cancer census association via MalaCards
Search PTEN in MalaCards View complete list of genes associated with diseases


  • Cowden syndrome 1 (CWS1) [MIM:158350]: An autosomal dominant hamartomatous polyposis syndrome with age-related penetrance. Cowden syndrome is characterized by hamartomatous lesions affecting derivatives of ectodermal, mesodermal and endodermal layers, macrocephaly, facial trichilemmomas (benign tumors of the hair follicle infundibulum), acral keratoses, papillomatous papules, and elevated risk for development of several types of malignancy, particularly breast carcinoma in women and thyroid carcinoma in both men and women. Colon cancer and renal cell carcinoma have also been reported. Hamartomas can be found in virtually every organ, but most commonly in the skin, gastrointestinal tract, breast and thyroid. {ECO:0000269 PubMed:10051160, ECO:0000269 PubMed:10234502, ECO:0000269 PubMed:10400993, ECO:0000269 PubMed:10866302, ECO:0000269 PubMed:11230179, ECO:0000269 PubMed:11494117, ECO:0000269 PubMed:15355975, ECO:0000269 PubMed:18716620, ECO:0000269 PubMed:9140396, ECO:0000269 PubMed:9241266, ECO:0000269 PubMed:9259288, ECO:0000269 PubMed:9345101, ECO:0000269 PubMed:9399897, ECO:0000269 PubMed:9425889, ECO:0000269 PubMed:9467011, ECO:0000269 PubMed:9600246, ECO:0000269 PubMed:9735393, ECO:0000269 PubMed:9797362, ECO:0000269 PubMed:9811831, ECO:0000269 PubMed:9832031, ECO:0000269 PubMed:9915974}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Lhermitte-Duclos disease (LDD) [MIM:158350]: A rare disease characterized by the occurrence of a slowly enlarging mass within the cerebellar cortex corresponding histologically to a cerebellar hamartoma. It manifests, most commonly in the third and fourth decades of life, with increased intracranial pressure, headache, nausea, cerebellar dysfunction, occlusive hydrocephalus, ataxia, visual disturbances and other cranial nerve palsies. Various associated abnormalities may be present such as megalencephaly, microgyria, hydromyelia, polydactyly, partial gigantism, macroglossia. LDD is part of the PTEN hamartoma tumor syndromes spectrum that also includes Cowden syndrome. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Squamous cell carcinoma of the head and neck (HNSCC) [MIM:275355]: A non-melanoma skin cancer affecting the head and neck. The hallmark of cutaneous SCC is malignant transformation of normal epidermal keratinocytes. {ECO:0000269 PubMed:11801303}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Endometrial cancer (ENDMC) [MIM:608089]: A malignancy of endometrium, the mucous lining of the uterus. Most endometrial cancers are adenocarcinomas, cancers that begin in cells that make and release mucus and other fluids. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
  • Note=PTEN mutations are found in a subset of patients with Proteus syndrome, a genetically heterogeneous condition. The molecular diagnosis of PTEN mutation positive cases classifies Proteus syndrome patients as part of the PTEN hamartoma syndrome spectrum. As such, patients surviving the early years of Proteus syndrome are likely at a greater risk of developing malignancies.
  • Glioma 2 (GLM2) [MIM:613028]: Gliomas are benign or malignant central nervous system neoplasms derived from glial cells. They comprise astrocytomas and glioblastoma multiforme that are derived from astrocytes, oligodendrogliomas derived from oligodendrocytes and ependymomas derived from ependymocytes. {ECO:0000269 PubMed:12085208}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
  • Prostate cancer (PC) [MIM:176807]: A malignancy originating in tissues of the prostate. Most prostate cancers are adenocarcinomas that develop in the acini of the prostatic ducts. Other rare histopathologic types of prostate cancer that occur in approximately 5% of patients include small cell carcinoma, mucinous carcinoma, prostatic ductal carcinoma, transitional cell carcinoma, squamous cell carcinoma, basal cell carcinoma, adenoid cystic carcinoma (basaloid), signet-ring cell carcinoma and neuroendocrine carcinoma. {ECO:0000269 PubMed:26504226, ECO:0000269 PubMed:9072974}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
  • Macrocephaly/autism syndrome (MCEPHAS) [MIM:605309]: Patients have autism spectrum disorders and macrocephaly, with head circumferences ranging from +2.5 to +8 SD for age and sex (average head circumference +4.0 SD). {ECO:0000269 PubMed:15805158, ECO:0000269 PubMed:23160955, ECO:0000269 PubMed:26637798}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Note=A microdeletion of chromosome 10q23 involving BMPR1A and PTEN is a cause of chromosome 10q23 deletion syndrome, which shows overlapping features of the following three disorders: Bannayan-Zonana syndrome, Cowden disease and juvenile polyposis syndrome.

Additional Disease Information for PTEN

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PTEN: view

No data available for Genatlas for PTEN Gene

Publications for PTEN Gene

  1. Rak functions as a tumor suppressor by regulating PTEN protein stability and function. (PMID: 19345329) Yim EK … Lin SY (Cancer cell 2009) 3 4 23 56
  2. PTEN genomic deletion is associated with p-Akt and AR signalling in poorer outcome, hormone refractory prostate cancer. (PMID: 19402094) Sircar K … Squire JA (The Journal of pathology 2009) 3 23 43 56
  3. Clinicopathological and molecular analysis of endometrial carcinoma associated with tamoxifen. (PMID: 18500270) Turbiner J … Palacios J (Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 2008) 3 23 43 56
  4. The deubiquitinylation and localization of PTEN are regulated by a HAUSP-PML network. (PMID: 18716620) Song MS … Pandolfi PP (Nature 2008) 3 4 23 56
  5. A functional genetic approach identifies the PI3K pathway as a major determinant of trastuzumab resistance in breast cancer. (PMID: 17936563) Berns K … Bernards R (Cancer cell 2007) 3 23 43 56

Products for PTEN Gene