Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PSMD7 Gene

Aliases for PSMD7 Gene

  • Proteasome 26S Subunit, Non-ATPase 7 2 3 5
  • Proteasome (Prosome, Macropain) 26S Subunit, Non-ATPase, 7 (Mov34 Homolog) 2 3
  • 26S Proteasome Regulatory Subunit S12 3 4
  • Proteasome Subunit P40 3 4
  • Mov34 Homolog 2 3
  • Proteasome (Prosome, Macropain) 26S Subunit, Non-ATPase, 7 2
  • 26S Proteasome Non-ATPase Regulatory Subunit 7 3
  • Moloney Leukemia Virus-34 Proviral Integration 3
  • 26S Proteasome Regulatory Subunit Rpn8 3
  • 26S Proteasome Regulatory Subunit RPN8 4
  • Mov34 Protein Homolog 4
  • MOV34L 4
  • MOV34 3
  • Rpn8 3
  • P40 3
  • S12 3

External Ids for PSMD7 Gene

Previous GeneCards Identifiers for PSMD7 Gene

  • GC16P065261
  • GC16P075291
  • GC16P074069
  • GC16P074110
  • GC16P072888
  • GC16P074330
  • GC16P060097

Summaries for PSMD7 Gene

Entrez Gene Summary for PSMD7 Gene

  • The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008]

GeneCards Summary for PSMD7 Gene

PSMD7 (Proteasome 26S Subunit, Non-ATPase 7) is a Protein Coding gene. Diseases associated with PSMD7 include Hereditary Renal Cell Carcinoma. Among its related pathways are Cell Cycle, Mitotic and RET signaling. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity. An important paralog of this gene is EIF3F.

UniProtKB/Swiss-Prot for PSMD7 Gene

  • Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair.

Gene Wiki entry for PSMD7 Gene

Additional gene information for PSMD7 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PSMD7 Gene

Genomics for PSMD7 Gene

GeneHancer (GH) Regulatory Elements for PSMD7 Gene

Promoters and enhancers for PSMD7 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16J074295 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 650.7 +0.1 115 3.4 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 ZNF213 E2F8 ZNF143 LOC101928035 PSMD7 ENSG00000214331 RPL21P118 ENSG00000259972 ENSG00000260884 RFWD3 WDR59 NPIPB15
GH16J074366 Promoter/Enhancer 1.7 Ensembl ENCODE dbSUPER 10.4 +71.4 71423 2.4 CLOCK MLX ARID4B SIN3A FEZF1 DMAP1 ZNF2 POLR2B E2F8 KLF13 ENSG00000261079 ENSG00000214331 LOC283922 PSMD7 CLEC18B RFWD3
GH16J074274 Enhancer 0.6 VISTA 11.4 -21.8 -21766 0.7 CTCF ZNF654 REST ZNF384 RAD21 RFX5 SMC3 ZNF143 CUX1 PSMD7 ENSG00000261248 LOC101928035 PPIAP49
GH16J074275 Enhancer 0.3 ENCODE 11.4 -20.9 -20853 0.5 CTCF PSMD7 ENSG00000261248 LOC101928035 PPIAP49
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PSMD7 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PSMD7 gene promoter:
  • LCR-F1
  • C/EBPalpha
  • AML1a
  • POU3F2 (N-Oct-5b)
  • POU3F2 (N-Oct-5a)
  • POU3F2
  • HNF-3beta

Genomic Locations for PSMD7 Gene

Genomic Locations for PSMD7 Gene
9,514 bases
Plus strand
9,514 bases
Plus strand

Genomic View for PSMD7 Gene

Genes around PSMD7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PSMD7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PSMD7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PSMD7 Gene

Proteins for PSMD7 Gene

  • Protein details for PSMD7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    26S proteasome non-ATPase regulatory subunit 7
    Protein Accession:
    Secondary Accessions:
    • D3DWS9
    • Q6PKI2
    • Q96E97

    Protein attributes for PSMD7 Gene

    324 amino acids
    Molecular mass:
    37025 Da
    Quaternary structure:
    • Component of the 19S proteasome regulatory particle complex. The 26S proteasome consists of a 20S core particle (CP) and two 19S regulatory subunits (RP). The regulatory particle is made of a lid composed of 9 subunits including PSMD7, a base containing 6 ATPases and few additional components (PubMed:27428775, PubMed:27342858). Within the complex, PSMD7 interacts with subunit PSMD4 through their respective MPN domain. Interacts with TRIM5 (PubMed:22078707).
    • Does not bind a metal ion.
    • Sequence=AAH00338.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for PSMD7 Gene

neXtProt entry for PSMD7 Gene

Post-translational modifications for PSMD7 Gene

  • Ubiquitination at posLast=279279, Lys204, posLast=199199, Lys180, posLast=113113, Lys103, posLast=100100, and posLast=4545
  • Modification sites at PhosphoSitePlus

Other Protein References for PSMD7 Gene

No data available for DME Specific Peptides for PSMD7 Gene

Domains & Families for PSMD7 Gene

Gene Families for PSMD7 Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Predicted intracellular proteins

Protein Domains for PSMD7 Gene

Suggested Antigen Peptide Sequences for PSMD7 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the peptidase M67A family.
  • Belongs to the peptidase M67A family.
genes like me logo Genes that share domains with PSMD7: view

Function for PSMD7 Gene

Molecular function for PSMD7 Gene

UniProtKB/Swiss-Prot Function:
Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair.
GENATLAS Biochemistry:
multicatalytic proteinase complex (prosome,macropain,26S),19/22S regulator of proteasome,non -ATPase subunit p40,Mov34 homolog,interferon gamma inducible

Gene Ontology (GO) - Molecular Function for PSMD7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI,IEA 14743216
GO:0042803 protein homodimerization activity IDA 17559875
genes like me logo Genes that share ontologies with PSMD7: view
genes like me logo Genes that share phenotypes with PSMD7: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PSMD7

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PSMD7 Gene

Localization for PSMD7 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PSMD7 gene
Compartment Confidence
extracellular 5
nucleus 5
cytosol 4
plasma membrane 2
endoplasmic reticulum 2
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for PSMD7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000502 proteasome complex IEA,IDA 17323924
GO:0005576 extracellular region TAS --
GO:0005634 nucleus HDA 21630459
GO:0005654 nucleoplasm TAS,IDA --
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with PSMD7: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for PSMD7 Gene

Pathways & Interactions for PSMD7 Gene

SuperPathways for PSMD7 Gene

SuperPathway Contained pathways
1 CDK-mediated phosphorylation and removal of Cdc6
2 RET signaling
3 Chks in Checkpoint Regulation
4 HIV Life Cycle
5 Class I MHC mediated antigen processing and presentation
genes like me logo Genes that share pathways with PSMD7: view

Gene Ontology (GO) - Biological Process for PSMD7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000165 MAPK cascade TAS --
GO:0000209 protein polyubiquitination TAS --
GO:0002223 stimulatory C-type lectin receptor signaling pathway TAS --
GO:0002479 antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent TAS --
GO:0006521 regulation of cellular amino acid metabolic process TAS --
genes like me logo Genes that share ontologies with PSMD7: view

No data available for SIGNOR curated interactions for PSMD7 Gene

Drugs & Compounds for PSMD7 Gene

(2) Drugs for PSMD7 Gene - From: DGIdb

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Bortezomib Approved, Investigational Pharma inhibitor, other Proteosome and NF-kappaB inhibitor, Other, Proteasome inhibitors 826
carfilzomib Approved, Investigational Pharma other, Inhibitor Other, 20S Proteasome Inhibitor 0
genes like me logo Genes that share compounds with PSMD7: view

Transcripts for PSMD7 Gene

mRNA/cDNA for PSMD7 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(408) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PSMD7 Gene

Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PSMD7

Alternative Splicing Database (ASD) splice patterns (SP) for PSMD7 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b · 8c
SP1: - - -
SP2: - - - -
SP3: - -
SP4: -
SP5: -

Relevant External Links for PSMD7 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PSMD7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PSMD7 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for PSMD7 Gene

This gene is overexpressed in Breast (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PSMD7 Gene

Protein tissue co-expression partners for PSMD7 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PSMD7 Gene:


SOURCE GeneReport for Unigene cluster for PSMD7 Gene:


Evidence on tissue expression from TISSUES for PSMD7 Gene

  • Liver(4.4)
  • Lung(4.4)
  • Skin(4.3)
  • Nervous system(2.4)
  • Heart(2.2)
  • Muscle(2.1)
genes like me logo Genes that share expression patterns with PSMD7: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PSMD7 Gene

Orthologs for PSMD7 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PSMD7 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PSMD7 34 33
  • 99.59 (n)
(Monodelphis domestica)
Mammalia PSMD7 34
  • 98 (a)
(Bos Taurus)
Mammalia PSMD7 34 33
  • 93.04 (n)
(Ornithorhynchus anatinus)
Mammalia PSMD7 34
  • 92 (a)
(Canis familiaris)
Mammalia PSMD7 34 33
  • 91.87 (n)
(Rattus norvegicus)
Mammalia Psmd7 33
  • 90.53 (n)
(Mus musculus)
Mammalia Psmd7 16 34 33
  • 90.29 (n)
(Gallus gallus)
Aves PSMD7 34 33
  • 86.33 (n)
(Anolis carolinensis)
Reptilia PSMD7 34
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia psmd7 33
  • 80.7 (n)
Str.6354 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.23830 33
(Danio rerio)
Actinopterygii psmd7 34 33
  • 81.87 (n)
wufi03c01 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2398 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP012135 33
  • 74.04 (n)
fruit fly
(Drosophila melanogaster)
Insecta Mov34 34 35 33
  • 72.75 (n)
(Caenorhabditis elegans)
Secernentea rpn-8 34 33
  • 67.26 (n)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AAL116W 33
  • 60.02 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes RPN8 36 34 33
  • 56.28 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0C09526g 33
  • 53.74 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons RPN8A 33
  • 63.08 (n)
(Glycine max)
eudicotyledons Gma.5368 33
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.1252 33
(Oryza sativa)
Liliopsida Os04g0661900 33
  • 60.96 (n)
Os.5973 33
(Hordeum vulgare)
Liliopsida Hv.3245 33
(Zea mays)
Liliopsida Zm.477 33
(Triticum aestivum)
Liliopsida Ta.2207 33
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 70 (a)
Cin.4256 33
bread mold
(Neurospora crassa)
Ascomycetes NCU01547 33
  • 60.71 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes rpn8 33
  • 58.09 (n)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.4256 33
Species where no ortholog for PSMD7 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for PSMD7 Gene

Gene Tree for PSMD7 (if available)
Gene Tree for PSMD7 (if available)
Evolutionary constrained regions (ECRs) for PSMD7: view image

Paralogs for PSMD7 Gene

Paralogs for PSMD7 Gene Pseudogenes for PSMD7 Gene

genes like me logo Genes that share paralogs with PSMD7: view

Variants for PSMD7 Gene

Sequence variations from dbSNP and Humsavar for PSMD7 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1000120332 -- 74,297,249(+) AGTTCGTTTTGCCGAAGTTCGTTTT/AGTTCGTTTT intron_variant
rs1000126706 -- 74,296,511(+) GGG/GG upstream_transcript_variant
rs1000348428 -- 74,298,396(+) G/A intron_variant
rs1000684672 -- 74,297,108(+) T/C intron_variant
rs1000912779 -- 74,303,091(+) G/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PSMD7 Gene

Variant ID Type Subtype PubMed ID
esv22159 CNV gain+loss 19812545
esv2758656 CNV gain+loss 17122850
esv2762054 CNV gain 21179565
esv3571520 CNV gain 25503493
esv3639059 CNV gain 21293372
nsv1065964 CNV gain 25217958
nsv7285 OTHER inversion 18451855
nsv827736 CNV gain 20364138
nsv833276 CNV loss 17160897
nsv833277 CNV loss 17160897

Variation tolerance for PSMD7 Gene

Residual Variation Intolerance Score: 20.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.59; 12.73% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PSMD7 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PSMD7 Gene

Disorders for PSMD7 Gene

MalaCards: The human disease database

(1) MalaCards diseases for PSMD7 Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
hereditary renal cell carcinoma
- elite association - COSMIC cancer census association via MalaCards
Search PSMD7 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for PSMD7

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PSMD7: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PSMD7 Gene

Publications for PSMD7 Gene

  1. cDNA cloning of p40, a regulatory subunit of the human 26S proteasome, and a homolog of the Mov-34 gene product. (PMID: 7755639) Tsurumi C … Tanaka K (Biochemical and biophysical research communications 1995) 2 3 4 22 58
  2. The crystal structure of the human Mov34 MPN domain reveals a metal-free dimer. (PMID: 17559875) Sanches M … Guimarães BG (Journal of molecular biology 2007) 3 4 22 58
  3. TRIM5α associates with proteasomal subunits in cells while in complex with HIV-1 virions. (PMID: 22078707) Lukic Z … Campbell EM (Retrovirology 2011) 3 4 58
  4. Fine mapping and association studies of a high-density lipoprotein cholesterol linkage region on chromosome 16 in French-Canadian subjects. (PMID: 19844255) Dastani Z … Genest J (European journal of human genetics : EJHG 2010) 3 44 58
  5. Mass spectrometric characterization of the affinity-purified human 26S proteasome complex. (PMID: 17323924) Wang X … Huang L (Biochemistry 2007) 3 4 58

Products for PSMD7 Gene

Sources for PSMD7 Gene

Loading form....