Aliases for PRKCZ-AS1 Gene

Subcategory (RNA class) for PRKCZ-AS1 Gene

lncRNA

Quality Score for this RNA gene is

15

Aliases for PRKCZ-AS1 Gene

  • PRKCZ Antisense RNA 1 2 3 5
  • PRKCZ-AS1 2 170
  • NONHSAG000139 94
  • HSALNG0000226 169

External Ids for PRKCZ-AS1 Gene

Previous GeneCards Identifiers for PRKCZ-AS1 Gene

  • GC00U936772

Summaries for PRKCZ-AS1 Gene

GeneCards Summary for PRKCZ-AS1 Gene

PRKCZ-AS1 (PRKCZ Antisense RNA 1) is an RNA Gene, and is affiliated with the lncRNA class. Diseases associated with PRKCZ-AS1 include Lung Cancer Susceptibility 3.

Additional gene information for PRKCZ-AS1 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PRKCZ-AS1 Gene

Genomics for PRKCZ-AS1 Gene

GeneHancer (GH) Regulatory Elements for PRKCZ-AS1 Gene

Promoters and enhancers for PRKCZ-AS1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PRKCZ-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for PRKCZ-AS1 Gene

Genomic Locations for PRKCZ-AS1 Gene
chr1:2,181,794-2,184,389
(GRCh38/hg38)
Size:
2,596 bases
Orientation:
Minus strand
chr1:2,113,233-2,115,828
(GRCh37/hg19)
Size:
2,596 bases
Orientation:
Minus strand

Genomic View for PRKCZ-AS1 Gene

Genes around PRKCZ-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PRKCZ-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PRKCZ-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PRKCZ-AS1 Gene

Proteins for PRKCZ-AS1 Gene

Post-translational modifications for PRKCZ-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for PRKCZ-AS1 Gene

Domains & Families for PRKCZ-AS1 Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for PRKCZ-AS1 Gene

Function for PRKCZ-AS1 Gene

Phenotypes From GWAS Catalog for PRKCZ-AS1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for PRKCZ-AS1 Gene

Localization for PRKCZ-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for PRKCZ-AS1 Gene

Pathways & Interactions for PRKCZ-AS1 Gene

PathCards logo

SuperPathways for PRKCZ-AS1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for PRKCZ-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for PRKCZ-AS1 Gene

Drugs & Compounds for PRKCZ-AS1 Gene

No Compound Related Data Available

Transcripts for PRKCZ-AS1 Gene

mRNA/cDNA for PRKCZ-AS1 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(3) NONCODE transcripts :
(3) RNACentral transcripts :
(1) LncBook transcripts :
(3) LNCipedia transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for PRKCZ-AS1 Gene

No ASD Table

Relevant External Links for PRKCZ-AS1 Gene

GeneLoc Exon Structure for
PRKCZ-AS1
ECgene alternative splicing isoforms for
PRKCZ-AS1

Expression for PRKCZ-AS1 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for PRKCZ-AS1 Gene

Orthologs for PRKCZ-AS1 Gene

Evolution for PRKCZ-AS1 Gene

ENSEMBL:
Gene Tree for PRKCZ-AS1 (if available)
TreeFam:
Gene Tree for PRKCZ-AS1 (if available)

No data available for Orthologs for PRKCZ-AS1 Gene

Paralogs for PRKCZ-AS1 Gene

No data available for Paralogs for PRKCZ-AS1 Gene

Variants for PRKCZ-AS1 Gene

Sequence variations from dbSNP and Humsavar for PRKCZ-AS1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1000498949 -- 2,183,577(-) G/A/C non_coding_transcript_variant
rs1001101043 -- 2,181,521(-) GAAAAGGTGTCAGGCACCATG/G downstream_transcript_variant
rs1001439812 -- 2,183,525(-) G/A intron_variant
rs1001768311 -- 2,182,638(-) C/T non_coding_transcript_variant
rs1003160949 -- 2,181,862(-) T/C non_coding_transcript_variant

Additional Variant Information for PRKCZ-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
PRKCZ-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for PRKCZ-AS1 Gene

Disorders for PRKCZ-AS1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for PRKCZ-AS1 Gene - From: LncRNADisease

Disorder Aliases PubMed IDs
lung cancer susceptibility 3
  • lncr3
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for PRKCZ-AS1

genes like me logo Genes that share disorders with PRKCZ-AS1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PRKCZ-AS1 Gene

Publications for PRKCZ-AS1 Gene

  1. Detection and Analysis of Wnt Pathway Related lncRNAs Expression Profile in Lung Adenocarcinoma. (PMID: 26857641) Chen J … Wang Y (Pathology oncology research : POR 2016) 2 3 56
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 56
  3. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 56

Products for PRKCZ-AS1 Gene

Sources for PRKCZ-AS1 Gene