Free for academic non-profit institutions. Other users need a Commercial license
This gene encodes a transcriptional regulator of sensory neuronal specification that plays a critical role in pain perception. The encoded protein contains an N-terminal PRDI-BF1 and RIZ homology (PR) domain, a SET domain, and three C-terminal C2H2 zinc finger DNA-binding domains. Naturally occurring mutations in this gene are associated with congenital insensitivity to pain (CIP), and hereditary sensory and autonomic neuropathies (HSAN's) affecting peripheral sensory and autonomic neurons. Deregulation of this gene is associated with solid cancers and hematological malignancies including chronic myeloid leukaemia. [provided by RefSeq, Mar 2017]
PRDM12 (PR/SET Domain 12) is a Protein Coding gene. Diseases associated with PRDM12 include Neuropathy, Hereditary Sensory And Autonomic, Type Viii and Factitious Disorder. Gene Ontology (GO) annotations related to this gene include methyltransferase activity. An important paralog of this gene is ZNF683.
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH09J130664 | Promoter/Enhancer | 0.8 | Ensembl ENCODE | 750.6 | +0.0 | 7 | 0.4 | GLIS2 PATZ1 EZH2 ZBTB17 ZFHX2 ZNF335 ZNF398 | PRDM12 piR-58662 RF00017-7997 | |
GH09J130665 | Enhancer | 0.6 | VISTA Ensembl | 750.6 | +1.3 | 1290 | 1.4 | EZH2 | PRDM12 QRFP piR-58662 RF00017-7997 | |
GH09J130666 | Promoter | 0.5 | Ensembl | 750.6 | -0.9 | -893 | 0.2 | EZH2 BCL6 | PRDM12 RF00017-8001 RF00017-7997 | |
GH09J130663 | Enhancer | 0.3 | ENCODE | 750.6 | -0.6 | -575 | 0.1 | SP1 EZH2 | PRDM12 RF00017-8001 RF00017-7997 | |
GH09J130467 | Enhancer | 1.2 | FANTOM5 Ensembl CraniofacialAtlas dbSUPER | 21.4 | -197.8 | -197786 | 2.4 | CTCF RAD21 SP1 ZIC2 RXRA POLR2A SCRT2 JUND ATF3 YY1 | PRDM12 TOR1A lnc-QRFP-1 RF01210-403 ASS1 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000977 | RNA polymerase II regulatory region sequence-specific DNA binding | IBA | 21873635 |
GO:0000981 | DNA-binding transcription factor activity, RNA polymerase II-specific | ISM | 19274049 |
GO:0003676 | nucleic acid binding | IEA | -- |
GO:0003677 | DNA binding | IEA | -- |
GO:0003700 | DNA-binding transcription factor activity | IBA | 21873635 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005634 | nucleus | IDA,IBA | 26005867 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
GO:0006357 | regulation of transcription by RNA polymerase II | IEA | -- |
GO:0019233 | sensory perception of pain | IMP | 26005867 |
GO:0022008 | neurogenesis | IBA,IEA | 21873635 |
GO:0031175 | neuron projection development | IMP | 26005867 |
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | PRDM12 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | PRDM12 33 |
|
OneToOne | |
LOC608616 32 |
|
||||
cow (Bos Taurus) |
Mammalia | PRDM12 33 32 |
|
OneToOne | |
oppossum (Monodelphis domestica) |
Mammalia | PRDM12 33 |
|
OneToOne | |
platypus (Ornithorhynchus anatinus) |
Mammalia | PRDM12 33 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Prdm12 17 33 32 |
|
||
rat (Rattus norvegicus) |
Mammalia | Prdm12 32 |
|
||
chicken (Gallus gallus) |
Aves | PRDM12 33 32 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | prdm12 32 |
|
||
African clawed frog (Xenopus laevis) |
Amphibia | MGC68944 32 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | prdm12b 33 32 |
|
OneToOne | |
worm (Caenorhabditis elegans) |
Secernentea | set-17 33 |
|
OneToMany |
SNP ID | Clin | Chr 09 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs1288821918 | uncertain-significance, Neuropathy, hereditary sensory and autonomic, type VIII | 130,681,584(+) | CGCACGCGCACGCGC/CGCACGCGC/CGCACGCGCACGCGCACGCGC | coding_sequence_variant, inframe_deletion, inframe_insertion | |
rs1298266062 | uncertain-significance, Neuropathy, hereditary sensory and autonomic, type VIII | 130,681,594(+) | CGCGCCCGCGC/CGCGCCCGCGCCCGCGC | coding_sequence_variant, inframe_insertion | |
rs1344661944 | uncertain-significance, Neuropathy, hereditary sensory and autonomic, type VIII | 130,681,658(+) | A/G | coding_sequence_variant, missense_variant | |
rs138789124 | likely-benign, Neuropathy, hereditary sensory and autonomic, type VIII | 130,668,314(+) | GTGTGTGTGTGTGTGTG/GTGTGTG/GTGTGTGTGTGTGTG/GTGTGTGTGTGTGTGTGTG/GTGTGTGTGTGTGTGTGTGTG | intron_variant, splice_donor_variant | |
rs139493961 | likely-benign, Neuropathy, hereditary sensory and autonomic, type VIII | 130,668,169(+) | G/A | coding_sequence_variant, synonymous_variant |
Disorder | Aliases | PubMed IDs |
---|---|---|
neuropathy, hereditary sensory and autonomic, type viii |
|
|
factitious disorder |
|
|
hereditary sensory and autonomic neuropathy type 1 |
|
|