This gene encodes a transcriptional regulator of sensory neuronal specification that plays a critical role in pain perception. The encoded protein contains an N-terminal PRDI-BF1 and RIZ homology (PR) domain, a SET domain, and three C-terminal C2H2 zinc finger DNA-binding domains. Naturally occurring mutations in this gene are associated with congenital insensitivity to pain (C... See more...

Aliases for PRDM12 Gene

Aliases for PRDM12 Gene

  • PR/SET Domain 12 2 3 5
  • PR Domain Zinc Finger Protein 12 3 4
  • PR Domain Containing 12 2 3
  • PFM9 3 4
  • PR-Domain Zinc Finger Protein 12 2
  • PR Domain-Containing Protein 12 4
  • PR-Domain Containing Protein 12 2
  • PR Domain 12 2
  • EC 2.1.1.- 4
  • HSAN8 3

External Ids for PRDM12 Gene

Previous GeneCards Identifiers for PRDM12 Gene

  • GC09P124554
  • GC09P125086
  • GC09P126893
  • GC09P128816
  • GC09P130569
  • GC09P132529
  • GC09P133539
  • GC09P103027

Summaries for PRDM12 Gene

Entrez Gene Summary for PRDM12 Gene

  • This gene encodes a transcriptional regulator of sensory neuronal specification that plays a critical role in pain perception. The encoded protein contains an N-terminal PRDI-BF1 and RIZ homology (PR) domain, a SET domain, and three C-terminal C2H2 zinc finger DNA-binding domains. Naturally occurring mutations in this gene are associated with congenital insensitivity to pain (CIP), and hereditary sensory and autonomic neuropathies (HSAN's) affecting peripheral sensory and autonomic neurons. Deregulation of this gene is associated with solid cancers and hematological malignancies including chronic myeloid leukaemia. [provided by RefSeq, Mar 2017]

GeneCards Summary for PRDM12 Gene

PRDM12 (PR/SET Domain 12) is a Protein Coding gene. Diseases associated with PRDM12 include Neuropathy, Hereditary Sensory And Autonomic, Type Viii and Factitious Disorder. Gene Ontology (GO) annotations related to this gene include methyltransferase activity. An important paralog of this gene is ZNF683.

UniProtKB/Swiss-Prot Summary for PRDM12 Gene

Additional gene information for PRDM12 Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PRDM12 Gene

Genomics for PRDM12 Gene

GeneHancer (GH) Regulatory Elements for PRDM12 Gene

Promoters and enhancers for PRDM12 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J130664 Promoter/Enhancer 0.8 Ensembl ENCODE 750.6 +0.0 7 0.4 GLIS2 PATZ1 EZH2 ZBTB17 ZFHX2 ZNF335 ZNF398 PRDM12 piR-58662 RF00017-7997
GH09J130665 Enhancer 0.6 VISTA Ensembl 750.6 +1.3 1290 1.4 EZH2 PRDM12 QRFP piR-58662 RF00017-7997
GH09J130666 Promoter 0.5 Ensembl 750.6 -0.9 -893 0.2 EZH2 BCL6 PRDM12 RF00017-8001 RF00017-7997
GH09J130663 Enhancer 0.3 ENCODE 750.6 -0.6 -575 0.1 SP1 EZH2 PRDM12 RF00017-8001 RF00017-7997
GH09J130467 Enhancer 1.2 FANTOM5 Ensembl CraniofacialAtlas dbSUPER 21.4 -197.8 -197786 2.4 CTCF RAD21 SP1 ZIC2 RXRA POLR2A SCRT2 JUND ATF3 YY1 PRDM12 TOR1A lnc-QRFP-1 RF01210-403 ASS1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PRDM12 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PRDM12 gene promoter:
  • GATA-1
  • GATA-2
  • Ik-1
  • MZF-1
  • NF-AT
  • NF-AT1
  • NF-AT2
  • NF-AT3
  • NF-AT4

Genomic Locations for PRDM12 Gene

Genomic Locations for PRDM12 Gene
18,404 bases
Plus strand
18,404 bases
Plus strand

Genomic View for PRDM12 Gene

Genes around PRDM12 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PRDM12 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PRDM12 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PRDM12 Gene

Proteins for PRDM12 Gene

  • Protein details for PRDM12 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    PR domain zinc finger protein 12
    Protein Accession:
    Secondary Accessions:
    • A3KFK9

    Protein attributes for PRDM12 Gene

    367 amino acids
    Molecular mass:
    40403 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for PRDM12 Gene

neXtProt entry for PRDM12 Gene

Post-translational modifications for PRDM12 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for PRDM12 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for PRDM12 Gene

Domains & Families for PRDM12 Gene

Gene Families for PRDM12 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted secreted proteins

Protein Domains for PRDM12 Gene

Suggested Antigen Peptide Sequences for PRDM12 Gene

GenScript: Design optimal peptide antigens:
  • PR domain-containing protein 12 (PRD12_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the class V-like SAM-binding methyltransferase superfamily.
  • Belongs to the class V-like SAM-binding methyltransferase superfamily.
genes like me logo Genes that share domains with PRDM12: view

Function for PRDM12 Gene

Molecular function for PRDM12 Gene

UniProtKB/Swiss-Prot Function:
Involved in the positive regulation of histone H3-K9 dimethylation.

Enzyme Numbers (IUBMB) for PRDM12 Gene

Phenotypes From GWAS Catalog for PRDM12 Gene

Gene Ontology (GO) - Molecular Function for PRDM12 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000977 RNA polymerase II regulatory region sequence-specific DNA binding IBA 21873635
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific ISM 19274049
GO:0003676 nucleic acid binding IEA --
GO:0003677 DNA binding IEA --
GO:0003700 DNA-binding transcription factor activity IBA 21873635
genes like me logo Genes that share ontologies with PRDM12: view
genes like me logo Genes that share phenotypes with PRDM12: view

Human Phenotype Ontology for PRDM12 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for PRDM12 Gene

MGI Knock Outs for PRDM12:
  • Prdm12 Prdm12<tm2b(EUCOMM)Hmgu>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PRDM12

No data available for Transcription Factor Targets and HOMER Transcription for PRDM12 Gene

Localization for PRDM12 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PRDM12 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PRDM12 gene
Compartment Confidence
nucleus 5
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for PRDM12 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA,IBA 26005867
genes like me logo Genes that share ontologies with PRDM12: view

Pathways & Interactions for PRDM12 Gene

PathCards logo

SuperPathways for PRDM12 Gene

No Data Available

Interacting Proteins for PRDM12 Gene

Gene Ontology (GO) - Biological Process for PRDM12 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006357 regulation of transcription by RNA polymerase II IEA --
GO:0019233 sensory perception of pain IMP 26005867
GO:0022008 neurogenesis IBA,IEA 21873635
GO:0031175 neuron projection development IMP 26005867
genes like me logo Genes that share ontologies with PRDM12: view

No data available for Pathways by source and SIGNOR curated interactions for PRDM12 Gene

Drugs & Compounds for PRDM12 Gene

No Compound Related Data Available

Transcripts for PRDM12 Gene

mRNA/cDNA for PRDM12 Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(7) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PRDM12

Alternative Splicing Database (ASD) splice patterns (SP) for PRDM12 Gene

No ASD Table

Relevant External Links for PRDM12 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PRDM12 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PRDM12 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for PRDM12 Gene

This gene is overexpressed in Brain - Hypothalamus (x7.1), Brain - Cortex (x4.6), Brain - Anterior cingulate cortex (BA24) (x4.4), and Brain - Frontal Cortex (BA9) (x4.2).

Protein differential expression in normal tissues from HIPED for PRDM12 Gene

This gene is overexpressed in Lymph node (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for PRDM12 Gene

Protein tissue co-expression partners for PRDM12 Gene

NURSA nuclear receptor signaling pathways regulating expression of PRDM12 Gene:


SOURCE GeneReport for Unigene cluster for PRDM12 Gene:


mRNA Expression by UniProt/SwissProt for PRDM12 Gene:

Tissue specificity: Not found in adult tissues except in dorsal root ganglia.
genes like me logo Genes that share expression patterns with PRDM12: view

No data available for Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for PRDM12 Gene

Orthologs for PRDM12 Gene

This gene was present in the common ancestor of animals.

Orthologs for PRDM12 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PRDM12 33 32
  • 99.8 (n)
(Canis familiaris)
Mammalia PRDM12 33
  • 98 (a)
LOC608616 32
  • 94.39 (n)
(Bos Taurus)
Mammalia PRDM12 33 32
  • 94.01 (n)
(Monodelphis domestica)
Mammalia PRDM12 33
  • 94 (a)
(Ornithorhynchus anatinus)
Mammalia PRDM12 33
  • 93 (a)
(Mus musculus)
Mammalia Prdm12 17 33 32
  • 91.42 (n)
(Rattus norvegicus)
Mammalia Prdm12 32
  • 90.62 (n)
(Gallus gallus)
Aves PRDM12 33 32
  • 88.32 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia prdm12 32
  • 80.64 (n)
African clawed frog
(Xenopus laevis)
Amphibia MGC68944 32
(Danio rerio)
Actinopterygii prdm12b 33 32
  • 79.38 (n)
(Caenorhabditis elegans)
Secernentea set-17 33
  • 14 (a)
Species where no ortholog for PRDM12 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PRDM12 Gene

Gene Tree for PRDM12 (if available)
Gene Tree for PRDM12 (if available)
Evolutionary constrained regions (ECRs) for PRDM12: view image

Paralogs for PRDM12 Gene

Variants for PRDM12 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for PRDM12 Gene

The poly-alanine tract is polymorphic in the general population and contains a maximum of 14 alanines.

Sequence variations from dbSNP and Humsavar for PRDM12 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1288821918 uncertain-significance, Neuropathy, hereditary sensory and autonomic, type VIII 130,681,584(+) CGCACGCGCACGCGC/CGCACGCGC/CGCACGCGCACGCGCACGCGC coding_sequence_variant, inframe_deletion, inframe_insertion
rs1298266062 uncertain-significance, Neuropathy, hereditary sensory and autonomic, type VIII 130,681,594(+) CGCGCCCGCGC/CGCGCCCGCGCCCGCGC coding_sequence_variant, inframe_insertion
rs1344661944 uncertain-significance, Neuropathy, hereditary sensory and autonomic, type VIII 130,681,658(+) A/G coding_sequence_variant, missense_variant
rs138789124 likely-benign, Neuropathy, hereditary sensory and autonomic, type VIII 130,668,314(+) GTGTGTGTGTGTGTGTG/GTGTGTG/GTGTGTGTGTGTGTG/GTGTGTGTGTGTGTGTGTG/GTGTGTGTGTGTGTGTGTGTG intron_variant, splice_donor_variant
rs139493961 likely-benign, Neuropathy, hereditary sensory and autonomic, type VIII 130,668,169(+) G/A coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for PRDM12 Gene

Variant ID Type Subtype PubMed ID
nsv825122 CNV gain 20364138
nsv825123 CNV gain 20364138
nsv825124 CNV gain 20364138
nsv831735 CNV loss 17160897
nsv951788 CNV deletion 24416366

Variation tolerance for PRDM12 Gene

Residual Variation Intolerance Score: 27.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.76; 16.03% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PRDM12 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

Disorders for PRDM12 Gene

MalaCards: The human disease database

(3) MalaCards diseases for PRDM12 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards


  • Neuropathy, hereditary sensory and autonomic, 8 (HSAN8) [MIM:616488]: A form of hereditary sensory and autonomic neuropathy, a genetically and clinically heterogeneous group of disorders characterized by degeneration of dorsal root and autonomic ganglion cells, and by sensory and/or autonomic abnormalities. HSAN8 patients manifest congenital insensitivity to pain resulting in ulceration to the fingers, tongue, lips, and other distal appendages. Some patients may also have decreased sweating and tear production. {ECO:0000269 PubMed:26005867}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for PRDM12

genes like me logo Genes that share disorders with PRDM12: view

No data available for Genatlas for PRDM12 Gene

Publications for PRDM12 Gene

  1. Transcriptional regulator PRDM12 is essential for human pain perception. (PMID: 26005867) Chen YC … Senderek J (Nature genetics 2015) 3 4 56
  2. A potential role for PRDM12 in the pathogenesis of chronic myeloid leukaemia with derivative chromosome 9 deletion. (PMID: 14523459) Reid AG … Nacheva EP (Leukemia 2004) 2 3 56
  3. Congenital Insensitivity to Pain Overview (PMID: 29419974) Schon K … Woods CG (GeneReviews® 2018) 3 56
  4. Hereditary Sensory Polyneuropathy, Pain Insensitivity and Global Developmental Delay due to Novel Mutation in PRDM12 Gene. (PMID: 28050684) Saini AG … Singhi P (Indian journal of pediatrics 2017) 3 56
  5. Dynamic Protein Interactions of the Polycomb Repressive Complex 2 during Differentiation of Pluripotent Cells. (PMID: 27634302) Oliviero G … Cagney G (Molecular & cellular proteomics : MCP 2016) 3 56

Products for PRDM12 Gene

Sources for PRDM12 Gene