Free for academic non-profit institutions. Other users need a Commercial license

PPP3R1 Gene(Protein Coding)

Protein Phosphatase 3 Regulatory Subunit B, Alpha

GCID:
GC02M068143
GIFtS:
56
Genes Participants
UDN Logo

Aliases for PPP3R1 Gene

Aliases for PPP3R1 Gene

  • Protein Phosphatase 3 Regulatory Subunit B, Alpha 2 3 5
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform 2 3
  • Protein Phosphatase 2B Regulatory Subunit B Alpha 2 3
  • Protein Phosphatase 2B Regulatory Subunit 1 3 4
  • Calcineurin B, Type I (19kDa) 2 3
  • CNB 3 4
  • Protein Phosphatase 3 Regulatory Subunit B Alpha Isoform 1 4
  • Protein Phosphatase 3, Regulatory Subunit B, Alpha 2
  • Calcineurin Subunit B Type 1 3
  • CALNB1 3
  • CNA2 4
  • CNB1 3

External Ids for PPP3R1 Gene

Previous GeneCards Identifiers for PPP3R1 Gene

  • GC02M068539
  • GC02M068363
  • GC02M068324
  • GC02M068380
  • GC02M068261
  • GC02M068317
  • GC02M068259
  • GC02M068358
  • GC02M068405

Summaries for PPP3R1 Gene

GeneCards Summary for PPP3R1 Gene

PPP3R1 (Protein Phosphatase 3 Regulatory Subunit B, Alpha) is a Protein Coding gene. Diseases associated with PPP3R1 include Synostoses, Tarsal, Carpal, And Digital and Cervical Neuroblastoma. Among its related pathways are NFAT and Cardiac Hypertrophy and Circadian entrainment. Gene Ontology (GO) annotations related to this gene include calcium ion binding and calmodulin binding. An important paralog of this gene is ENSG00000273398.

UniProtKB/Swiss-Prot for PPP3R1 Gene

  • Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Gene Wiki entry for PPP3R1 Gene

Additional gene information for PPP3R1 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PPP3R1 Gene

Genomics for PPP3R1 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for PPP3R1 Gene

Promoters and enhancers for PPP3R1 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH02I068248 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 570.9 +4.6 4632 5.9 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 PPP3R1 WDR92 ETAA1 PNO1 LOC102724389 ENSG00000273398 GC02P067636
GH02I068255 Enhancer 0.6 Ensembl dbSUPER 557.7 +0.2 236 0.8 PKNOX1 RUNX3 PRDM1 PPP3R1 LOC102724389 ENSG00000273398 GC02P067636
GH02I068156 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 19.9 +98.2 98228 3 HDGF PKNOX1 CLOCK SMAD1 ARNT ARID4B NEUROD1 SIN3A DMAP1 YY1 PNO1 WDR92 PPP3R1 PIR60274 ENSG00000273398 GC02P067636
GH02I068190 Enhancer 1.1 Ensembl ENCODE dbSUPER 31.1 +64.9 64875 1.7 MEIS2 FOXA2 JUN CEBPG FOSL1 PRDM10 FOSL2 FOS ZNF362 CEBPB PPP3R1 WDR92 PNO1 ENSG00000273275 LOC102724389 ENSG00000273398 GC02P067636
GH02I068192 Enhancer 1.5 VISTA Ensembl ENCODE dbSUPER 18.6 +62.4 62396 2.2 JUN TAL1 CEBPG CHAMP1 FOSL1 TCF12 ZNF316 NCOR1 EGR1 CBFA2T2 WDR92 PPP3R1 PNO1 ENSG00000273275 LOC102724389 ENSG00000273398 GC02P067636
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around PPP3R1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PPP3R1 gene promoter:

Genomic Locations for PPP3R1 Gene

Genomic Locations for PPP3R1 Gene
chr2:68,178,857-68,256,237
(GRCh38/hg38)
Size:
77,381 bases
Orientation:
Minus strand
chr2:68,405,989-68,483,369
(GRCh37/hg19)

Genomic View for PPP3R1 Gene

Genes around PPP3R1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP3R1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP3R1 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for PPP3R1 Gene

Proteins for PPP3R1 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for PPP3R1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P63098-CANB1_HUMAN
    Recommended name:
    Calcineurin subunit B type 1
    Protein Accession:
    P63098
    Secondary Accessions:
    • B2RC10
    • B5MDU4
    • P06705
    • P15117
    • Q08044
    • Q53SL0

    Protein attributes for PPP3R1 Gene

    Size:
    170 amino acids
    Molecular mass:
    19300 Da
    Quaternary structure:
    • Interacts with CIB1 (via C-terminal region); the interaction increases upon cardiomyocytes hypertrophy (By similarity). Composed of a catalytic subunit (A) and a regulatory subunit (B).
    Miscellaneous:
    • This protein has four functional calcium-binding sites.

    Three dimensional structures from OCA and Proteopedia for PPP3R1 Gene

neXtProt entry for PPP3R1 Gene

Protein Expression for PPP3R1 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for PPP3R1 Gene

  • Ubiquitination at isoforms=125
  • Modification sites at PhosphoSitePlus

Other Protein References for PPP3R1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for PPP3R1 (Calcineurin B)
  • Cloud-Clone Corp. Antibodies for PPP3R1

No data available for DME Specific Peptides for PPP3R1 Gene

Domains & Families for PPP3R1 Gene

Gene Families for PPP3R1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for PPP3R1 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for PPP3R1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P63098

UniProtKB/Swiss-Prot:

CANB1_HUMAN :
  • Belongs to the calcineurin regulatory subunit family.
Family:
  • Belongs to the calcineurin regulatory subunit family.
genes like me logo Genes that share domains with PPP3R1: view

Function for PPP3R1 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for PPP3R1 Gene

GENATLAS Biochemistry:
calcineurin B,calmodulin dependent protein serine/threonine phosphatase 3,regulatory subunit
UniProtKB/Swiss-Prot Function:
Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Phenotypes From GWAS Catalog for PPP3R1 Gene

Gene Ontology (GO) - Molecular Function for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004721 phosphoprotein phosphatase activity IEA --
GO:0004723 calcium-dependent protein serine/threonine phosphatase activity NAS 2558868
GO:0005509 calcium ion binding NAS,IEA 2558868
GO:0005515 protein binding IPI 8524402
GO:0005516 calmodulin binding NAS 2558868
genes like me logo Genes that share ontologies with PPP3R1: view
genes like me logo Genes that share phenotypes with PPP3R1: view

Animal Models for PPP3R1 Gene

MGI Knock Outs for PPP3R1:

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for PPP3R1 Gene

Localization for PPP3R1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PPP3R1 Gene

Cytoplasm, cytosol. Cell membrane. Cell membrane, sarcolemma. Membrane; Lipid-anchor. Note=Translocates from the cytosol to the sarcolemma in a CIB1-dependent manner during cardiomyocytes hypertrophy. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PPP3R1 gene
Compartment Confidence
cytosol 5
plasma membrane 4
nucleus 4
mitochondrion 2
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm TAS --
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion IEA --
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane IEA --
genes like me logo Genes that share ontologies with PPP3R1: view

Pathways & Interactions for PPP3R1 Gene

genes like me logo Genes that share pathways with PPP3R1: view

Pathways by source for PPP3R1 Gene

1 PharmGKB pathway for PPP3R1 Gene

Gene Ontology (GO) - Biological Process for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001569 branching involved in blood vessel morphogenesis IEA --
GO:0001837 epithelial to mesenchymal transition IEA --
GO:0006470 protein dephosphorylation IEA --
GO:0007223 Wnt signaling pathway, calcium modulating pathway TAS --
GO:0007507 heart development IEA --
genes like me logo Genes that share ontologies with PPP3R1: view

No data available for SIGNOR curated interactions for PPP3R1 Gene

Drugs & Compounds for PPP3R1 Gene

Products:

  1. Drug

(6) Drugs for PPP3R1 Gene - From: DrugBank, ApexBio, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Cyclosporin A Approved, Investigational, Vet_approved Pharma Antagonist Immunosuppressant drug, Immunosuppressive agent, Calcineurin inhibitor 0
calcium Approved Nutra 0
Pimecrolimus Approved, Investigational Pharma 64
Myristic acid Experimental Pharma Target 0
Voclosporin Investigational Pharma Target 0

(2) ApexBio Compounds for PPP3R1 Gene

Compound Action Cas Number
Cyclosporine Immunosuppressant drug 79217-60-0
Pimecrolimus 137071-32-0
genes like me logo Genes that share compounds with PPP3R1: view

Drug Products

Transcripts for PPP3R1 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for PPP3R1 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(430) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PPP3R1 Gene

Protein phosphatase 3, regulatory subunit B, alpha:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP3R1 Gene

No ASD Table

Relevant External Links for PPP3R1 Gene

GeneLoc Exon Structure for
PPP3R1
ECgene alternative splicing isoforms for
PPP3R1

Expression for PPP3R1 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PPP3R1 Gene

mRNA expression in normal human tissues for PPP3R1 Gene
mRNA expression by GTEx for PPP3R1 GenemRNA expression by BioGPS for PPP3R1 Gene

mRNA differential expression in normal tissues according to GTEx for PPP3R1 Gene

This gene is overexpressed in Brain - Frontal Cortex (BA9) (x4.5).

Protein differential expression in normal tissues from HIPED for PPP3R1 Gene

This gene is overexpressed in Brain (24.9) and Fetal Brain (8.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PPP3R1 Gene



Protein tissue co-expression partners for PPP3R1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PPP3R1 Gene:

PPP3R1

SOURCE GeneReport for Unigene cluster for PPP3R1 Gene:

Hs.280604

Evidence on tissue expression from TISSUES for PPP3R1 Gene

  • Blood(4.4)
  • Nervous system(2.9)
  • Muscle(2.3)
  • Lung(2.2)
  • Spleen(2.2)
  • Heart(2)
  • Liver(2)
genes like me logo Genes that share expression patterns with PPP3R1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP3R1 Gene

Orthologs for PPP3R1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PPP3R1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia PPP3R1 33
  • 100 (n)
oppossum
(Monodelphis domestica)
 Mammalia -- 34
  • 98 (a)
 ManyToMany
cow
(Bos Taurus)
 Mammalia PPP3R1 33 34
  • 97.06 (n)
WDR92 34
  • 3 (a)
 ManyToMany
dog
(Canis familiaris)
 Mammalia PPP3R1 33
  • 95.46 (n)
-- 34
  • 22 (a)
 OneToMany
mouse
(Mus musculus)
 Mammalia Ppp3r1 33 16 34
  • 94.51 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia -- 34
  • 94 (a)
 ManyToMany
-- 34
  • 3 (a)
 ManyToMany
rat
(Rattus norvegicus)
 Mammalia Ppp3r1 33
  • 92.35 (n)
chicken
(Gallus gallus)
 Aves PPP3R1 33 34
  • 91.18 (n)
WDR92 34
  • 3 (a)
 ManyToMany
lizard
(Anolis carolinensis)
 Reptilia -- 34
  • 23 (a)
 OneToMany
tropical clawed frog
(Silurana tropicalis)
 Amphibia ppp3r1 33
  • 86.08 (n)
MGC75600 33
zebrafish
(Danio rerio)
 Actinopterygii ppp3r1a 33 34
  • 80.59 (n)
wdr92 34
  • 2 (a)
 ManyToMany
nrarpa 33
fruit fly
(Drosophila melanogaster)
 Insecta CanB 35
  • 85 (a)
CanB2 35 33
  • 72.16 (n)
CG14353 34
  • 1 (a)
 OneToMany
African malaria mosquito
(Anopheles gambiae)
 Insecta AgaP_AGAP004298 33
  • 70.59 (n)
worm
(Caenorhabditis elegans)
 Secernentea cnb-1 33
  • 68.04 (n)
K. lactis yeast
(Kluyveromyces lactis)
 Saccharomycetes KLLA0D02992g 33
  • 64.3 (n)
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes CNB1 33
  • 58.76 (n)
A. gosspyii yeast
(Ashbya gossypii)
 Saccharomycetes AGOS_AER096C 33
  • 58.13 (n)
thale cress
(Arabidopsis thaliana)
 eudicotyledons AT3G18430 33
  • 46.1 (n)
rice
(Oryza sativa)
 Liliopsida Os08g0442300 33
  • 47.15 (n)
fission yeast
(Schizosaccharomyces pombe)
 Schizosaccharomycetes SPCC830.06 33
  • 59.02 (n)
bread mold
(Neurospora crassa)
 Ascomycetes NCU03833 33
  • 58.45 (n)
sea squirt
(Ciona savignyi)
 Ascidiacea -- 34
  • 3 (a)
 OneToMany
sea squirt
(Ciona intestinalis)
 Ascidiacea Cin.14820 33
Species where no ortholog for PPP3R1 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PPP3R1 Gene

ENSEMBL:
Gene Tree for PPP3R1 (if available)
TreeFam:
Gene Tree for PPP3R1 (if available)

Paralogs for PPP3R1 Gene

Paralogs for PPP3R1 Gene

(30) SIMAP similar genes for PPP3R1 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with PPP3R1: view

Variants for PPP3R1 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for PPP3R1 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs3039851 not-provided, not provided 68,218,182(-) TTAATTTAA/TTAA/TTAATTTAATTTAA intron_variant
rs72174030 not-provided, not provided 68,252,587(-) G/GGCGGAGGCGGGGGCGCGCGCGGGCCGGCG upstream_transcript_variant
rs1000039131 -- 68,219,085(-) A/G intron_variant
rs1000067912 -- 68,210,324(-) T/C intron_variant
rs1000104324 -- 68,191,306(-) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PPP3R1 Gene

Variant ID Type Subtype PubMed ID
nsv1072948 CNV deletion 25765185
nsv1126551 CNV deletion 24896259
nsv834251 CNV loss 17160897
nsv953138 CNV duplication 24416366

Variation tolerance for PPP3R1 Gene

Residual Variation Intolerance Score: 55.3% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PPP3R1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
PPP3R1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP3R1 Gene

Disorders for PPP3R1 Gene

MalaCards: The human disease database

(7) MalaCards diseases for PPP3R1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
synostoses, tarsal, carpal, and digital
  • calcaneonavicular coalition
cervical neuroblastoma
extracranial neuroblastoma
ascaridiasis
  • ascariasis
breast abscess
  • abscess of breast
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for PPP3R1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PPP3R1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PPP3R1 Gene

Publications for PPP3R1 Gene

  1. Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. (PMID: 16209992) Tang W … Ferrell RE (American heart journal 2005) 3 22 44 58
  2. Isolation and sequence of a cDNA clone for human calcineurin B, the Ca2+-binding subunit of the Ca2+/calmodulin-stimulated protein phosphatase. (PMID: 2558868) Guerini D … Klee CB (DNA (Mary Ann Liebert, Inc.) 1989) 2 3 4 58
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
  4. SNPs associated with cerebrospinal fluid phospho-tau levels influence rate of decline in Alzheimer's disease. (PMID: 20862329) Cruchaga C … Goate AM (PLoS genetics 2010) 3 44 58
  5. Pharmacogenetics of antipsychotic response in the CATIE trial: a candidate gene analysis. (PMID: 19156168) Need AC … Goldstein DB (European journal of human genetics : EJHG 2009) 3 44 58

Products for PPP3R1 Gene

Sources for PPP3R1 Gene

Content
Loading form....