Aliases for PPP3R1 Gene
Aliases for PPP3R1 Gene
- Protein Phosphatase 3 Regulatory Subunit B, Alpha 2 3 5
- Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) 2 3
- Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) 2 3
- Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform 2 3
- Protein Phosphatase 2B Regulatory Subunit B Alpha 2 3
- Protein Phosphatase 2B Regulatory Subunit 1 3 4
- Calcineurin B, Type I (19kDa) 2 3
- CNB 3 4
External Ids for PPP3R1 Gene
- HGNC: 9317
- Entrez Gene: 5534
- Ensembl: ENSG00000221823
- OMIM: 601302
- UniProtKB: P63098
Previous GeneCards Identifiers for PPP3R1 Gene
- GC02M068539
- GC02M068363
- GC02M068324
- GC02M068380
- GC02M068261
- GC02M068317
- GC02M068259
- GC02M068358
- GC02M068405
Summaries for PPP3R1 Gene
GeneCards Summary for PPP3R1 Gene
PPP3R1 (Protein Phosphatase 3 Regulatory Subunit B, Alpha) is a Protein Coding gene. Diseases associated with PPP3R1 include Synostoses, Tarsal, Carpal, And Digital and Extracranial Neuroblastoma. Among its related pathways are Antigen activates B Cell Receptor (BCR) leading to generation of second messengers and T cell receptor signaling pathway. Gene Ontology (GO) annotations related to this gene include calcium ion binding and calmodulin binding. An important paralog of this gene is ENSG00000273398.
UniProtKB/Swiss-Prot for PPP3R1 Gene
-
Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.
Additional gene information for PPP3R1 Gene
- Monarch Initiative
- Search for PPP3R1 at DataMed
- Search for PPP3R1 at HumanCyc
No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PPP3R1 Gene
Genomics for PPP3R1 Gene
GeneHancer (GH) Regulatory Elements for PPP3R1 Gene
Promoters and enhancers for PPP3R1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around PPP3R1 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the PPP3R1 gene promoter:
-
- GR-alpha
- GR
- AP-1
- FOXO4
- aMEF-2
- MEF-2
- MEF-2A
- c-Ets-1
Regulatory Element Products
Genomic Locations for PPP3R1 Gene
Genomic Locations for PPP3R1 Gene
- chr2:68,178,857-68,256,237
- (GRCh38/hg38)
- Size:
- 77,381 bases
- Orientation:
- Minus strand
- chr2:68,405,989-68,483,369
- (GRCh37/hg19)
- Size:
- 77,381 bases
- Orientation:
- Minus strand
Genomic View for PPP3R1 Gene
Genes around PPP3R1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 2p14 by Entrez Gene
- 2p14 by HGNC
- 2p14 by Ensembl
PPP3R1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for PPP3R1 Gene
Proteins for PPP3R1 Gene
-
Protein details for PPP3R1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P63098-CANB1_HUMAN
- Recommended name:
- Calcineurin subunit B type 1
- Protein Accession:
- P63098
- B2RC10
- B5MDU4
- P06705
- P15117
- Q08044
- Q53SL0
Protein attributes for PPP3R1 Gene
- Size:
- 170 amino acids
- Molecular mass:
- 19300 Da
- Quaternary structure:
-
- Interacts with CIB1 (via C-terminal region); the interaction increases upon cardiomyocytes hypertrophy (By similarity). Composed of a catalytic subunit (A) and a regulatory subunit (B).
- Miscellaneous:
-
- This protein has four functional calcium-binding sites.
Protein Expression for PPP3R1 Gene
Post-translational modifications for PPP3R1 Gene
Other Protein References for PPP3R1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for PPP3R1 (Calcineurin B)
-
Custom Antibody ServicesOriGene Antibodies for PPP3R1
- Novus Biologicals Antibodies for PPP3R1
-
Abcam antibodies for PPP3R1
- Invitrogen Antibodies for PPP3R1
- GeneTex PPP3R1 Antibody for PPP3R1
-
Boster Bio Antibodies for PPP3R1
-
Santa Cruz Biotechnology (SCBT) Antibodies for PPP3R1
- Sino Biological Antibodies for PPP3R1
Protein Products
-
OriGene Purified Proteins for PPP3R1
- Search Origene for MassSpec and Protein Over-expression Lysates for PPP3R1
- Origene Custom Protein Services for PPP3R1
- Sino Biological Recombinant Proteins for PPP3R1
- Sino Biological Cell Lysates for PPP3R1
- ProSpec Recombinant Proteins for PPP3R1
- GeneTex Proteins for PPP3R1
-
ProSci Proteins for PPP3R1
-
Abcam proteins for PPP3R1
Assay Products
No data available for DME Specific Peptides for PPP3R1 Gene
Domains & Families for PPP3R1 Gene
Gene Families for PPP3R1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Protein Domains for PPP3R1 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for PPP3R1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P63098- Family:
-
- Belongs to the calcineurin regulatory subunit family.
Function for PPP3R1 Gene
Molecular function for PPP3R1 Gene
- UniProtKB/Swiss-Prot Function:
- Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.
- GENATLAS Biochemistry:
- calcineurin B,calmodulin dependent protein serine/threonine phosphatase 3,regulatory subunit
Phenotypes From GWAS Catalog for PPP3R1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004721 | phosphoprotein phosphatase activity | IEA | -- |
| GO:0004723 | calcium-dependent protein serine/threonine phosphatase activity | NAS | 2558868 |
| GO:0005509 | calcium ion binding | NAS,IEA | 2558868 |
| GO:0005515 | protein binding | IPI | 8524402 |
| GO:0005516 | calmodulin binding | NAS | 2558868 |
Phenotypes for PPP3R1 Gene
- MGI mutant phenotypes for PPP3R1:
-
inferred from 4 alleles
- cardiovascular system phenotype
- homeostasis/metabolism phenotype
- nervous system phenotype
- behavior/neurological phenotype
- endocrine/exocrine gland phenotype
- mortality/aging
- cellular phenotype
- embryo phenotype
- renal/urinary system phenotype
- hematopoietic system phenotype
- immune system phenotype
- growth/size/body region phenotype
- GenomeRNAi human phenotypes for PPP3R1:
-
- Condensed cis-Golgi
- Moderately decreased NFAT1-GFP nuclear translocation
- Decreased focal adhesion (FA) area, decreased FA length, decreased FA mean intensity, increased number of small and round FAs, increased FA abundance
- Synthetic lethal with c-Myc after tamoxifen stimulation
- Increased cell migration
- Decreased cell migration
- Decreased viability
- no effect
- shRNA abundance <= 50%
- Lamellipodia cells
Animal Models for PPP3R1 Gene
- MGI Knock Outs for PPP3R1:
-
- Ppp3r1 Ppp3r1<tm2.1Grc>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for PPP3R1
-
CRISPR Products
-
OriGene CRISPR knockouts for PPP3R1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP3R1
- genomics-online: gRNA clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- Applied Biological Materials CRISPR for PPP3R1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for PPP3R1
- GenScript: Design CRISPR guide RNA sequences for PPP3R1
miRNA for PPP3R1 Gene
- miRTarBase miRNAs that target PPP3R1
-
- hsa-mir-30a-5p (MIRT005180)
- hsa-mir-183-5p (MIRT025005)
- hsa-mir-34a-5p (MIRT025426)
- hsa-mir-26b-5p (MIRT029303)
- hsa-mir-24-3p (MIRT030457)
- hsa-mir-532-3p (MIRT037914)
- hsa-mir-5189-3p (MIRT159806)
- hsa-mir-33a-3p (MIRT303230)
- hsa-mir-409-3p (MIRT303233)
- hsa-mir-376a-3p (MIRT439908)
- hsa-mir-369-3p (MIRT439909)
- hsa-mir-20a-5p (MIRT439910)
- hsa-mir-106b-5p (MIRT439911)
- hsa-mir-9-3p (MIRT442615)
- hsa-mir-4714-3p (MIRT442616)
- hsa-mir-656-3p (MIRT442617)
- hsa-mir-6763-3p (MIRT510950)
- hsa-mir-6758-3p (MIRT510951)
- hsa-mir-5587-3p (MIRT510952)
- hsa-mir-4707-5p (MIRT510953)
- hsa-mir-4704-5p (MIRT510954)
- hsa-mir-651-3p (MIRT521719)
- hsa-mir-548as-3p (MIRT521720)
- hsa-mir-548z (MIRT521721)
- hsa-mir-548h-3p (MIRT521722)
- hsa-mir-548d-3p (MIRT521723)
- hsa-mir-548bb-3p (MIRT521724)
- hsa-mir-548ac (MIRT521725)
- hsa-mir-578 (MIRT566293)
- hsa-mir-340-5p (MIRT566294)
- hsa-mir-3185 (MIRT566295)
- hsa-mir-3163 (MIRT566296)
- hsa-mir-5692a (MIRT571779)
- hsa-mir-629-3p (MIRT654811)
- hsa-mir-5006-3p (MIRT654812)
- hsa-mir-4755-5p (MIRT654813)
- hsa-mir-519e-5p (MIRT654814)
- hsa-mir-515-5p (MIRT654815)
- hsa-mir-623 (MIRT654816)
- hsa-mir-6734-3p (MIRT654817)
- hsa-mir-6756-3p (MIRT654818)
- hsa-mir-3127-3p (MIRT654819)
- hsa-mir-211-5p (MIRT654820)
- hsa-mir-204-5p (MIRT654821)
- hsa-mir-519d-3p (MIRT726875)
- hsa-mir-93-5p (MIRT726876)
- hsa-mir-17-5p (MIRT726877)
- hsa-mir-20b-5p (MIRT726878)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP3R1
- Browse OriGene Inhibitory RNA Products For PPP3R1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP3R1
- genomics-online: shRNA clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
Clone Products
- Sino Biological Human cDNA Clone for PPP3R1
- VectorBuilder custom plasmid, inducible vectors for PPP3R1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for PPP3R1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for PPP3R1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP3R1
- Applied Biological Materials Clones for PPP3R1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for PPP3R1
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for PPP3R1 Gene
Localization for PPP3R1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for PPP3R1 Gene
- Cytoplasm, cytosol. Cell membrane. Cell membrane, sarcolemma. Membrane; Lipid-anchor. Note=Translocates from the cytosol to the sarcolemma in a CIB1-dependent manner during cardiomyocytes hypertrophy. {ECO:0000250}.
| Compartment | Confidence |
|---|---|
| cytosol | 5 |
| plasma membrane | 4 |
| nucleus | 4 |
| mitochondrion | 2 |
| endoplasmic reticulum | 1 |
- Cytosol (2)
- Plasma membrane (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0005737 | cytoplasm | IEA | -- |
| GO:0005739 | mitochondrion | IEA | -- |
| GO:0005829 | cytosol | TAS | -- |
| GO:0005886 | plasma membrane | IEA | -- |
Pathways & Interactions for PPP3R1 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Activation of cAMP-Dependent PKA |
.77
|
.56
|
| 2 | TCR Signaling (Qiagen) |
.68
|
|
| 3 | CDK-mediated phosphorylation and removal of Cdc6 |
.41
|
.31
|
| 4 | ICos-ICosL Pathway in T-Helper Cell | ||
| 5 | NFAT and Cardiac Hypertrophy |
.37
|
|
Pathways by source for PPP3R1 Gene
3 Sino Biological pathways for PPP3R1 Gene
4 BioSystems pathways for PPP3R1 Gene
19 Reactome pathways for PPP3R1 Gene
1 PharmGKB pathway for PPP3R1 Gene
26 KEGG pathways for PPP3R1 Gene
4 GeneGo (Thomson Reuters) pathways for PPP3R1 Gene
- Development Role of HDAC and calcium/calmodulin-dependent kinase (CaMK) in control of skeletal myogenesis
- Immune response CD16 signaling in NK cells
- Neurophysiological process Glutamate regulation of Dopamine D1A receptor signaling
- Signal transduction Activation of PKC via G-Protein coupled receptor
4 R&D Systems pathways for PPP3R1 Gene
32 Qiagen pathways for PPP3R1 Gene
Interacting Proteins for PPP3R1 Gene
Selected Interacting proteins:
P63098-CANB1_HUMAN
ENSP00000234310
for PPP3R1 Gene via
UniProtKB
STRING
MINT
IID
GPS-Prot Interaction Network for PPP3R1
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001569 | branching involved in blood vessel morphogenesis | IEA | -- |
| GO:0001837 | epithelial to mesenchymal transition | IEA | -- |
| GO:0006470 | protein dephosphorylation | IEA | -- |
| GO:0006606 | protein import into nucleus | IEA | -- |
| GO:0007223 | Wnt signaling pathway, calcium modulating pathway | TAS | -- |
No data available for SIGNOR curated interactions for PPP3R1 Gene
Drugs & Compounds for PPP3R1 Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| Cyclosporin A | Approved, Investigational, Vet_approved | Pharma | Antagonist, Inhibition, Inhibitor | Immunosuppressant drug, Immunosuppressive agent, Calcineurin inhibitor | 0 | |
| calcium | Approved | Nutra | 0 | |||
| Pimecrolimus | Approved, Investigational | Pharma | 64 | |||
| Myristic acid | Experimental | Pharma | Target | 0 | ||
| Voclosporin | Investigational | Pharma | Target | 0 |
Drug Products
Transcripts for PPP3R1 Gene
mRNA/cDNA for PPP3R1 Gene
- (1) REFSEQ mRNAs :
- (4) Additional mRNA sequences :
- (430) Selected AceView cDNA sequences:
- (3) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000234310 3023 bps (uc002sei.2)
- ENST00000409752 851 bps (uc061jye.1)
- ENST00000409377 684 bps (uc061jyf.1)
Unigene Clusters for PPP3R1 Gene
- Protein phosphatase 3, regulatory subunit B, alpha:
- Representative Sequences:
CRISPR Products
-
OriGene CRISPR knockouts for PPP3R1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP3R1
- genomics-online: gRNA clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- Applied Biological Materials CRISPR for PPP3R1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for PPP3R1
- GenScript: Design CRISPR guide RNA sequences for PPP3R1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP3R1
- Browse OriGene Inhibitory RNA Products For PPP3R1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP3R1
- genomics-online: shRNA clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
Clone Products
- Sino Biological Human cDNA Clone for PPP3R1
- VectorBuilder custom plasmid, inducible vectors for PPP3R1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for PPP3R1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for PPP3R1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP3R1
- Applied Biological Materials Clones for PPP3R1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for PPP3R1 Gene
mRNA differential expression in normal tissues according to GTEx for PPP3R1 Gene
This gene is overexpressed in Brain - Frontal Cortex (BA9) (x4.5).
This gene is overexpressed in Brain (24.9) and Fetal Brain (8.5).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PPP3R1 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of PPP3R1 Gene:
PPP3R1SOURCE GeneReport for Unigene cluster for PPP3R1 Gene:
Hs.280604Evidence on tissue expression from TISSUES for PPP3R1 Gene
- Blood(4.4)
- Nervous system(2.9)
- Muscle(2.3)
- Lung(2.2)
- Spleen(2.2)
- Heart(2)
- Liver(2)
Primer Products
-
OriGene qPCR primer pairs and template standards for PPP3R1
-
OriGene qPCR primer pairs for PPP3R1
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP3R1 Gene
Orthologs for PPP3R1 Gene
This gene was present in the common ancestor of eukaryotes.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | PPP3R1 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | -- 34 |
|
ManyToMany | |
| cow (Bos Taurus) |
Mammalia | PPP3R1 34 33 |
|
ManyToMany | |
| WDR92 34 |
|
ManyToMany | |||
| dog (Canis familiaris) |
Mammalia | PPP3R1 33 |
|
||
| -- 34 |
|
OneToMany | |||
| mouse (Mus musculus) |
Mammalia | Ppp3r1 16 34 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 34 |
|
ManyToMany | |
| -- 34 |
|
ManyToMany | |||
| rat (Rattus norvegicus) |
Mammalia | Ppp3r1 33 |
|
||
| chicken (Gallus gallus) |
Aves | PPP3R1 34 33 |
|
ManyToMany | |
| WDR92 34 |
|
ManyToMany | |||
| lizard (Anolis carolinensis) |
Reptilia | -- 34 |
|
OneToMany | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | ppp3r1 33 |
|
||
| MGC75600 33 |
|
||||
| zebrafish (Danio rerio) |
Actinopterygii | ppp3r1a 34 33 |
|
ManyToMany | |
| wdr92 34 |
|
ManyToMany | |||
| nrarpa 33 |
|
||||
| fruit fly (Drosophila melanogaster) |
Insecta | CanB 35 |
|
|
|
| CanB2 35 33 |
|
||||
| CG14353 34 |
|
OneToMany | |||
| African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP004298 33 |
|
||
| worm (Caenorhabditis elegans) |
Secernentea | cnb-1 33 |
|
||
| K. lactis yeast (Kluyveromyces lactis) |
Saccharomycetes | KLLA0D02992g 33 |
|
||
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | CNB1 33 |
|
||
| A. gosspyii yeast (Ashbya gossypii) |
Saccharomycetes | AGOS_AER096C 33 |
|
||
| thale cress (Arabidopsis thaliana) |
eudicotyledons | AT3G18430 33 |
|
||
| rice (Oryza sativa) |
Liliopsida | Os08g0442300 33 |
|
||
| fission yeast (Schizosaccharomyces pombe) |
Schizosaccharomycetes | SPCC830.06 33 |
|
||
| bread mold (Neurospora crassa) |
Ascomycetes | NCU03833 33 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToMany | |
| Cin.14820 33 |
|
||||
| sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.14820 33 |
|
- Species where no ortholog for PPP3R1 was found in the sources mined by GeneCards:
-
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for PPP3R1 Gene
- ENSEMBL:
- Gene Tree for PPP3R1 (if available)
- TreeFam:
- Gene Tree for PPP3R1 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for PPP3R1: view image
Paralogs for PPP3R1 Gene
(30) SIMAP similar genes for PPP3R1 Gene using alignment to 3 proteins:
- CANB1_HUMAN
- D3YTA9_HUMAN
- F6U1T9_HUMAN
Variants for PPP3R1 Gene
| SNP ID | Clin | Chr 02 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs3039851 | not-provided, not provided | 68,218,182(-) | TTAATTTAA/TTAA/TTAATTTAATTTAA | intron_variant | |
| rs72174030 | not-provided, not provided | 68,252,587(-) | G/GGCGGAGGCGGGGGCGCGCGCGGGCCGGCG | upstream_transcript_variant | |
| rs1000039131 | -- | 68,219,085(-) | A/G | intron_variant | |
| rs1000067912 | -- | 68,210,324(-) | T/C | intron_variant | |
| rs1000104324 | -- | 68,191,306(-) | A/G | intron_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv1072948 | CNV | deletion | 25765185 |
| nsv1126551 | CNV | deletion | 24896259 |
| nsv834251 | CNV | loss | 17160897 |
| nsv953138 | CNV | duplication | 24416366 |
Residual Variation Intolerance Score:
55.3% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for PPP3R1 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- PPP3R1
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP3R1 Gene
Disorders for PPP3R1 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| synostoses, tarsal, carpal, and digital |
|
|
| extracranial neuroblastoma |
|
|
| cervical neuroblastoma |
|
|
| ascaridiasis |
|
|
| breast abscess |
|
|
Search PPP3R1 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for PPP3R1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for PPP3R1 Gene
Publications for PPP3R1 Gene
- Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. (PMID: 16209992) Tang W … Ferrell RE (American heart journal 2005) 3 22 44 58
- Isolation and sequence of a cDNA clone for human calcineurin B, the Ca2+-binding subunit of the Ca2+/calmodulin-stimulated protein phosphatase. (PMID: 2558868) Guerini D … Klee CB (DNA (Mary Ann Liebert, Inc.) 1989) 2 3 4 58
- Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
- SNPs associated with cerebrospinal fluid phospho-tau levels influence rate of decline in Alzheimer's disease. (PMID: 20862329) Cruchaga C … Goate AM (PLoS genetics 2010) 3 44 58
- High-density association study of 383 candidate genes for volumetric BMD at the femoral neck and lumbar spine among older men. (PMID: 19453261) Yerges LM … MrOS Research Group (Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 2009) 3 44 58
Products for PPP3R1 Gene
- R&D Systems Antibodies for PPP3R1 (Calcineurin B)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for PPP3R1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for PPP3R1
- Search Origene for MassSpec and Protein Over-expression Lysates for PPP3R1
- Origene Custom Protein Services for PPP3R1
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP3R1
- Browse OriGene Inhibitory RNA Products For PPP3R1
- OriGene qPCR primer pairs and template standards for PPP3R1
- OriGene qPCR primer pairs for PPP3R1
- OriGene CRISPR knockouts for PPP3R1
- OriGene ORF clones in human for PPP3R1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For PPP3R1
- GenScript: Next-day shipping of latest version cDNA ORF clones for PPP3R1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for PPP3R1
- GenScript Custom Assay Services for PPP3R1
- GenScript Custom overexpressing Cell Line Services for PPP3R1
- GenScript: Design CRISPR guide RNA sequences for PPP3R1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for PPP3R1
- Sino Biological Human cDNA Clone for PPP3R1
- Sino Biological Recombinant Proteins for PPP3R1
- Sino Biological Cell Lysates for PPP3R1
- Sino Biological Antibodies for PPP3R1
- Browse Sino Biological Assays
- Browse Recombinant Proteins
- Browse Antibodies
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for PPP3R1
- Novus Biologicals lysates and proteins for PPP3R1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for PPP3R1
- Abcam proteins for PPP3R1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- ProSpec Recombinant Proteins for PPP3R1
- VectorBuilder custom plasmid, inducible vectors for PPP3R1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for PPP3R1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for PPP3R1
- antibodies-online: Search results for 30 available PPP3R1 Antibodies ranked by validation data
- Compare Top PPP3R1 Antibodies
- antibodies-online: Search results for 16 available PPP3R1 Elisa Kits ranked by validation data
- Compare Top PPP3R1 Elisa Kits
- antibodies-online: Search results for 12 available PPP3R1 Proteins ranked by validation data
- Compare Top PPP3R1 Proteins
- GeneTex PPP3R1 Antibody for PPP3R1
- GeneTex Proteins for PPP3R1
- Santa Cruz Biotechnology (SCBT) Antibodies for PPP3R1
- Search Santa Cruz Biotechnology (SCBT) for PPP3R1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for PPP3R1
- Search for PPP3R1 Antibodies at ProSci
- Custom Antibody Services
- ProSci Proteins for PPP3R1
- Horizon Cell Lines for PPP3R1
- genomics-online: cdna clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- orf clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- genomics-online: gRNA clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- genomics-online: primer clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- genomics-online: shRNA clones - Search results for 93 available PPP3R1 gene related products
- Overview of 93 available PPP3R1 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP3R1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP3R1
- GeneCopoeia miRNA 3'UTR Target clone products for PPP3R1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP3R1
- Boster Bio Antibodies for PPP3R1
- Browse Boster Bio ELISA Kits
Sources for PPP3R1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt