Aliases for PPP3R1 Gene

Aliases for PPP3R1 Gene

  • Protein Phosphatase 3 Regulatory Subunit B, Alpha 2 3 5
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform 2 3
  • Protein Phosphatase 2B Regulatory Subunit B Alpha 2 3
  • Protein Phosphatase 2B Regulatory Subunit 1 3 4
  • Calcineurin B, Type I (19kDa) 2 3
  • Calcineurin Subunit B Type 1 3 4
  • CNB 3 4
  • Protein Phosphatase 3 Regulatory Subunit B Alpha Isoform 1 4
  • Protein Phosphatase 3, Regulatory Subunit B, Alpha 2
  • CALNB1 3
  • CNB1 3
  • CNA2 4

External Ids for PPP3R1 Gene

Previous GeneCards Identifiers for PPP3R1 Gene

  • GC02M068539
  • GC02M068363
  • GC02M068324
  • GC02M068380
  • GC02M068261
  • GC02M068317
  • GC02M068259
  • GC02M068358
  • GC02M068405

Summaries for PPP3R1 Gene

GeneCards Summary for PPP3R1 Gene

PPP3R1 (Protein Phosphatase 3 Regulatory Subunit B, Alpha) is a Protein Coding gene. Diseases associated with PPP3R1 include Cervical Neuroblastoma and Extracranial Neuroblastoma. Among its related pathways are CLEC7A (Dectin-1) signaling and Wnt Signaling Pathways: beta-Catenin-dependent Wnt Signaling. Gene Ontology (GO) annotations related to this gene include calcium ion binding and calmodulin binding. An important paralog of this gene is ENSG00000273398.

UniProtKB/Swiss-Prot Summary for PPP3R1 Gene

  • Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Gene Wiki entry for PPP3R1 Gene

Additional gene information for PPP3R1 Gene

No data available for Entrez Gene Summary , CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PPP3R1 Gene

Genomics for PPP3R1 Gene

GeneHancer (GH) Regulatory Elements for PPP3R1 Gene

Promoters and enhancers for PPP3R1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J068248 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 770.8 +4.6 4613 6 SIN3A ZBTB40 CTCF RBPJ SMARCE1 POLR2A USF2 CREB1 HCFC1 MIXL1 PPP3R1 ENSG00000273064 lnc-PLEK-3 PLEK WDR92 ETAA1 PNO1 LOC102724389 ENSG00000273398
GH02J068317 Promoter/Enhancer 2.1 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas 750.2 -63.0 -62964 3.2 ZBTB6 L3MBTL2 ZNF148 ZFX SP7 GLIS2 POLR2A REST PRDM10 ZNF639 CNRIP1 PPP3R1 HSALNG0015684 lnc-PLEK-3 LOC102724389
GH02J068218 Promoter/Enhancer 0.8 EPDnew dbSUPER 761.7 +37.5 37547 0.1 MAFK NFE2L2 ZNF316 NFE2 MAFG EMSY PPP3R1 LOC102724389 ENSG00000273275 ENSG00000273398
GH02J068188 Promoter/Enhancer 0.6 EPDnew dbSUPER 760.9 +67.3 67268 0.1 YY1 PPP3R1 PNO1 WDR92 ENSG00000273275 LOC102724389 ENSG00000273398
GH02J068186 Promoter/Enhancer 0.5 EPDnew dbSUPER 750.2 +69.6 69648 0.1 PPP3R1 WDR92 PNO1 ENSG00000273275 LOC102724389 ENSG00000273398
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PPP3R1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PPP3R1 gene promoter:
  • aMEF-2
  • AP-1
  • c-Ets-1
  • FOXO4
  • GR
  • GR-alpha
  • MEF-2
  • MEF-2A

Genomic Locations for PPP3R1 Gene

Genomic Locations for PPP3R1 Gene
chr2:68,178,857-68,256,237
(GRCh38/hg38)
Size:
77,381 bases
Orientation:
Minus strand
chr2:68,405,989-68,483,369
(GRCh37/hg19)
Size:
77,381 bases
Orientation:
Minus strand

Genomic View for PPP3R1 Gene

Genes around PPP3R1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP3R1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP3R1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PPP3R1 Gene

Proteins for PPP3R1 Gene

  • Protein details for PPP3R1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P63098-CANB1_HUMAN
    Recommended name:
    Calcineurin subunit B type 1
    Protein Accession:
    P63098
    Secondary Accessions:
    • B2RC10
    • B5MDU4
    • P06705
    • P15117
    • Q08044
    • Q53SL0

    Protein attributes for PPP3R1 Gene

    Size:
    170 amino acids
    Molecular mass:
    19300 Da
    Quaternary structure:
    • Forms a complex composed of a calmodulin-dependent catalytic subunit (also known as calcineurin A) and a regulatory Ca(2+)-binding subunit (also known as calcineurin B) (PubMed:8524402, PubMed:12218175, PubMed:12357034, PubMed:17498738, PubMed:22343722, PubMed:23468591, PubMed:26794871, PubMed:27974827). There are three catalytic subunits, each encoded by a separate gene (PPP3CA, PPP3CB, and PPP3CC) and two regulatory subunits which are also encoded by separate genes (PPP3R1 and PPP3R2). Interacts with catalytic subunit PPP3CA/calcineurin A (PubMed:8524402, PubMed:12218175, PubMed:12357034, PubMed:17498738, PubMed:22343722, PubMed:23468591, PubMed:27974827). Interacts with catalytic subunit PPP3CB/calcineurin A (PubMed:26794871). Interacts with CIB1 (via C-terminal region); the interaction increases upon cardiomyocyte hypertrophy (By similarity). Interacts with RCAN1 (PubMed:12809556).
    Miscellaneous:
    • This protein has four functional calcium-binding sites (PubMed:8524402, PubMed:12218175, PubMed:12357034, PubMed:17498738, PubMed:22343722, PubMed:23468591, PubMed:26794871, PubMed:27974827). Although African swine fever virus infects pigs and not humans, human PPP3R1 and PPP3CA have been used for the crystallization. PPP3CA and PPP3R1 interact with African swine fever virus Mal-047/A238L (via PKIIIT and FLCVK motifs); the interaction does not block catalytic activity per se but inhibits PPP3CA function by blocking the access to the two substrate recognition (PubMed:23468591).

    Three dimensional structures from OCA and Proteopedia for PPP3R1 Gene

neXtProt entry for PPP3R1 Gene

Post-translational modifications for PPP3R1 Gene

  • Ubiquitination at Lys125
  • Modification sites at PhosphoSitePlus

Other Protein References for PPP3R1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for PPP3R1 Gene

Domains & Families for PPP3R1 Gene

Gene Families for PPP3R1 Gene

Suggested Antigen Peptide Sequences for PPP3R1 Gene

GenScript: Design optimal peptide antigens:
  • Protein phosphatase 3 regulatory subunit B alpha isoform 1 (CANB1_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P63098

UniProtKB/Swiss-Prot:

CANB1_HUMAN :
  • Belongs to the calcineurin regulatory subunit family.
Family:
  • Belongs to the calcineurin regulatory subunit family.
genes like me logo Genes that share domains with PPP3R1: view

Function for PPP3R1 Gene

Molecular function for PPP3R1 Gene

UniProtKB/Swiss-Prot Function:
Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.
GENATLAS Biochemistry:
calcineurin B,calmodulin dependent protein serine/threonine phosphatase 3,regulatory subunit

Phenotypes From GWAS Catalog for PPP3R1 Gene

Gene Ontology (GO) - Molecular Function for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004723 calcium-dependent protein serine/threonine phosphatase activity NAS 2558868
GO:0005509 calcium ion binding NAS,IEA 2558868
GO:0005515 protein binding IPI 8524402
GO:0005516 calmodulin binding NAS 2558868
GO:0016018 cyclosporin A binding IDA 12218175
genes like me logo Genes that share ontologies with PPP3R1: view
genes like me logo Genes that share phenotypes with PPP3R1: view

Animal Models for PPP3R1 Gene

MGI Knock Outs for PPP3R1:

Animal Model Products

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for PPP3R1 Gene

Localization for PPP3R1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PPP3R1 Gene

Cytoplasm, cytosol. Cell membrane. Cell membrane, sarcolemma. Cell membrane; Lipid-anchor. Note=Translocates from the cytosol to the sarcolemma in a CIB1-dependent manner during cardiomyocyte hypertrophy. {ECO:0000250 UniProtKB:Q63810}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PPP3R1 gene
Compartment Confidence
nucleus 4
cytosol 4
plasma membrane 3
mitochondrion 2
extracellular 1
cytoskeleton 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm TAS --
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion IEA --
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane IEA --
genes like me logo Genes that share ontologies with PPP3R1: view

Pathways & Interactions for PPP3R1 Gene

PathCards logo

SuperPathways for PPP3R1 Gene

SuperPathway Contained pathways
1 Activation of cAMP-Dependent PKA
.77
.77
.71
.56
2 TCR Signaling (Qiagen)
.68
.68
.54
.49
3 CDK-mediated phosphorylation and removal of Cdc6
.31
4 Human cytomegalovirus infection
5 ICos-ICosL Pathway in T-Helper Cell
.66
.66
.31
genes like me logo Genes that share pathways with PPP3R1: view

Pathways by source for PPP3R1 Gene

Gene Ontology (GO) - Biological Process for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006470 protein dephosphorylation IEA --
GO:0007223 Wnt signaling pathway, calcium modulating pathway TAS --
GO:0033173 calcineurin-NFAT signaling cascade IDA 22688515
GO:0038095 Fc-epsilon receptor signaling pathway TAS --
GO:0045944 positive regulation of transcription by RNA polymerase II IDA 22688515
genes like me logo Genes that share ontologies with PPP3R1: view

No data available for SIGNOR curated interactions for PPP3R1 Gene

Drugs & Compounds for PPP3R1 Gene

(7) Drugs for PPP3R1 Gene - From: DrugBank, ApexBio, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Calcium Approved Nutra 7773
Pimecrolimus Approved, Investigational Pharma 66
Myristic acid Experimental Pharma Target 0
Voclosporin Investigational Pharma Target 0
Cyclosporine Pharma Immunosuppressant drug 0

(2) ApexBio Compounds for PPP3R1 Gene

Compound Action Cas Number
Cyclosporine Immunosuppressant drug 79217-60-0
Pimecrolimus 137071-32-0
genes like me logo Genes that share compounds with PPP3R1: view

Transcripts for PPP3R1 Gene

mRNA/cDNA for PPP3R1 Gene

(1) REFSEQ mRNAs :
(6) Additional mRNA sequences :
(430) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP3R1 Gene

No ASD Table

Relevant External Links for PPP3R1 Gene

GeneLoc Exon Structure for
PPP3R1
ECgene alternative splicing isoforms for
PPP3R1

Expression for PPP3R1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PPP3R1 Gene

mRNA differential expression in normal tissues according to GTEx for PPP3R1 Gene

This gene is overexpressed in Brain - Frontal Cortex (BA9) (x4.5).

Protein differential expression in normal tissues from HIPED for PPP3R1 Gene

This gene is overexpressed in Brain (24.9) and Fetal Brain (8.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PPP3R1 Gene



Protein tissue co-expression partners for PPP3R1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PPP3R1 Gene:

PPP3R1

SOURCE GeneReport for Unigene cluster for PPP3R1 Gene:

Hs.280604

Evidence on tissue expression from TISSUES for PPP3R1 Gene

  • Blood(4.4)
  • Nervous system(2.9)
  • Muscle(2.3)
  • Lung(2.2)
  • Spleen(2.2)
  • Heart(2)
  • Liver(2)
genes like me logo Genes that share expression patterns with PPP3R1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP3R1 Gene

Orthologs for PPP3R1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PPP3R1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PPP3R1 32
  • 100 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 33
  • 98 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia PPP3R1 33 32
  • 97.06 (n)
ManyToMany
WDR92 33
  • 3 (a)
ManyToMany
dog
(Canis familiaris)
Mammalia PPP3R1 32
  • 95.46 (n)
-- 33
  • 22 (a)
OneToMany
mouse
(Mus musculus)
Mammalia Ppp3r1 17 33 32
  • 94.51 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 94 (a)
ManyToMany
-- 33
  • 3 (a)
ManyToMany
rat
(Rattus norvegicus)
Mammalia Ppp3r1 32
  • 92.35 (n)
chicken
(Gallus gallus)
Aves PPP3R1 33 32
  • 91.18 (n)
ManyToMany
WDR92 33
  • 3 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia -- 33
  • 23 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia ppp3r1 32
  • 86.08 (n)
MGC75600 32
zebrafish
(Danio rerio)
Actinopterygii ppp3r1a 33 32
  • 80.59 (n)
ManyToMany
wdr92 33
  • 2 (a)
ManyToMany
nrarpa 32
fruit fly
(Drosophila melanogaster)
Insecta CanB 34
  • 85 (a)
CanB2 34 32
  • 72.16 (n)
CG14353 33
  • 1 (a)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004298 32
  • 70.59 (n)
worm
(Caenorhabditis elegans)
Secernentea cnb-1 32
  • 68.04 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D02992g 32
  • 64.3 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CNB1 32
  • 58.76 (n)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AER096C 32
  • 58.13 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT3G18430 32
  • 46.1 (n)
rice
(Oryza sativa)
Liliopsida Os08g0442300 32
  • 47.15 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes SPCC830.06 32
  • 59.02 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU03833 32
  • 58.45 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 3 (a)
OneToMany
Cin.14820 32
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.14820 32
Species where no ortholog for PPP3R1 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PPP3R1 Gene

ENSEMBL:
Gene Tree for PPP3R1 (if available)
TreeFam:
Gene Tree for PPP3R1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PPP3R1: view image

Paralogs for PPP3R1 Gene

Paralogs for PPP3R1 Gene

(30) SIMAP similar genes for PPP3R1 Gene using alignment to 3 proteins:

  • CANB1_HUMAN
  • D3YTA9_HUMAN
  • F6U1T9_HUMAN
genes like me logo Genes that share paralogs with PPP3R1: view

Variants for PPP3R1 Gene

Sequence variations from dbSNP and Humsavar for PPP3R1 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs3039851 not-provided, not provided 68,218,182(-) TTAATTTAA/TTAA/TTAATTTAATTTAA intron_variant
rs72174030 not-provided, not provided 68,252,587(-) G/GGCGGAGGCGGGGGCGCGCGCGGGCCGGCG upstream_transcript_variant
rs1000039131 -- 68,219,085(-) A/G intron_variant
rs1000067912 -- 68,210,324(-) T/C intron_variant
rs1000104324 -- 68,191,306(-) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PPP3R1 Gene

Variant ID Type Subtype PubMed ID
nsv1072948 CNV deletion 25765185
nsv1126551 CNV deletion 24896259
nsv834251 CNV loss 17160897
nsv953138 CNV duplication 24416366

Variation tolerance for PPP3R1 Gene

Residual Variation Intolerance Score: 55.3% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PPP3R1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
PPP3R1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP3R1 Gene

Disorders for PPP3R1 Gene

MalaCards: The human disease database

(9) MalaCards diseases for PPP3R1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
cervical neuroblastoma
extracranial neuroblastoma
gallbladder small cell carcinoma
  • oat cell carcinoma of the gallbladder
ascaridiasis
  • ascariasis
pre-malignant neoplasm
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for PPP3R1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PPP3R1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PPP3R1 Gene

Publications for PPP3R1 Gene

  1. Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. (PMID: 16209992) Tang W … Ferrell RE (American heart journal 2005) 3 23 43 56
  2. Isolation and sequence of a cDNA clone for human calcineurin B, the Ca2+-binding subunit of the Ca2+/calmodulin-stimulated protein phosphatase. (PMID: 2558868) Guerini D … Klee CB (DNA (Mary Ann Liebert, Inc.) 1989) 2 3 4 56
  3. Investigating the human Calcineurin Interaction Network using the πɸLxVP SLiM. (PMID: 27974827) Sheftic SR … Peti W (Scientific reports 2016) 3 4 56
  4. Cooperative autoinhibition and multi-level activation mechanisms of calcineurin. (PMID: 26794871) Li SJ … Wang ZX (Cell research 2016) 3 4 56
  5. The molecular mechanism of substrate engagement and immunosuppressant inhibition of calcineurin. (PMID: 23468591) Grigoriu S … Peti W (PLoS biology 2013) 3 4 56

Products for PPP3R1 Gene

Sources for PPP3R1 Gene