Free for academic non-profit institutions. Other users need a Commercial license
Aliases for PPP3R1 Gene
Aliases for PPP3R1 Gene
- Protein Phosphatase 3 Regulatory Subunit B, Alpha 2 3 5
- Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) 2 3
- Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) 2 3
- Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform 2 3
- Protein Phosphatase 2B Regulatory Subunit B Alpha 2 3
- Protein Phosphatase 2B Regulatory Subunit 1 3 4
- Calcineurin B, Type I (19kDa) 2 3
External Ids for PPP3R1 Gene
- HGNC: 9317
- Entrez Gene: 5534
- Ensembl: ENSG00000221823
- OMIM: 601302
- UniProtKB: P63098
Previous GeneCards Identifiers for PPP3R1 Gene
- GC02M068539
- GC02M068363
- GC02M068324
- GC02M068380
- GC02M068261
- GC02M068317
- GC02M068259
- GC02M068358
- GC02M068405
Summaries for PPP3R1 Gene
GeneCards Summary for PPP3R1 Gene
PPP3R1 (Protein Phosphatase 3 Regulatory Subunit B, Alpha) is a Protein Coding gene. Diseases associated with PPP3R1 include Cervical Neuroblastoma and Extracranial Neuroblastoma. Among its related pathways are CLEC7A (Dectin-1) signaling and Wnt Signaling Pathways: beta-Catenin-dependent Wnt Signaling. Gene Ontology (GO) annotations related to this gene include calcium ion binding and calmodulin binding. An important paralog of this gene is ENSG00000273398.
UniProtKB/Swiss-Prot Summary for PPP3R1 Gene
-
Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.
Additional gene information for PPP3R1 Gene
- Monarch Initiative
- Search for PPP3R1 at DataMed
- Search for PPP3R1 at HumanCyc
No data available for Entrez Gene Summary , CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PPP3R1 Gene
Genomics for PPP3R1 Gene
GeneHancer (GH) Regulatory Elements for PPP3R1 Gene
Promoters and enhancers for PPP3R1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around PPP3R1 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the PPP3R1 gene promoter:
-
- aMEF-2
- AP-1
- c-Ets-1
- FOXO4
- GR
- GR-alpha
- MEF-2
- MEF-2A
Genomic Locations for PPP3R1 Gene
Genomic Locations for PPP3R1 Gene
- chr2:68,178,857-68,256,237
- (GRCh38/hg38)
- Size:
- 77,381 bases
- Orientation:
- Minus strand
- chr2:68,405,989-68,483,369
- (GRCh37/hg19)
- Size:
- 77,381 bases
- Orientation:
- Minus strand
Genomic View for PPP3R1 Gene
Genes around PPP3R1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 2p14 by HGNC
- 2p14 by Entrez Gene
- 2p14 by Ensembl
PPP3R1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for PPP3R1 Gene
Proteins for PPP3R1 Gene
-
Protein details for PPP3R1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P63098-CANB1_HUMAN
- Recommended name:
- Calcineurin subunit B type 1
- Protein Accession:
- P63098
- B2RC10
- B5MDU4
- P06705
- P15117
- Q08044
- Q53SL0
Protein attributes for PPP3R1 Gene
- Size:
- 170 amino acids
- Molecular mass:
- 19300 Da
- Quaternary structure:
-
- Forms a complex composed of a calmodulin-dependent catalytic subunit (also known as calcineurin A) and a regulatory Ca(2+)-binding subunit (also known as calcineurin B) (PubMed:8524402, PubMed:12218175, PubMed:12357034, PubMed:17498738, PubMed:22343722, PubMed:23468591, PubMed:26794871, PubMed:27974827). There are three catalytic subunits, each encoded by a separate gene (PPP3CA, PPP3CB, and PPP3CC) and two regulatory subunits which are also encoded by separate genes (PPP3R1 and PPP3R2). Interacts with catalytic subunit PPP3CA/calcineurin A (PubMed:8524402, PubMed:12218175, PubMed:12357034, PubMed:17498738, PubMed:22343722, PubMed:23468591, PubMed:27974827). Interacts with catalytic subunit PPP3CB/calcineurin A (PubMed:26794871). Interacts with CIB1 (via C-terminal region); the interaction increases upon cardiomyocyte hypertrophy (By similarity). Interacts with RCAN1 (PubMed:12809556).
- Miscellaneous:
-
- This protein has four functional calcium-binding sites (PubMed:8524402, PubMed:12218175, PubMed:12357034, PubMed:17498738, PubMed:22343722, PubMed:23468591, PubMed:26794871, PubMed:27974827). Although African swine fever virus infects pigs and not humans, human PPP3R1 and PPP3CA have been used for the crystallization. PPP3CA and PPP3R1 interact with African swine fever virus Mal-047/A238L (via PKIIIT and FLCVK motifs); the interaction does not block catalytic activity per se but inhibits PPP3CA function by blocking the access to the two substrate recognition (PubMed:23468591).
Protein Expression for PPP3R1 Gene
Post-translational modifications for PPP3R1 Gene
Other Protein References for PPP3R1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- G Biosciences Immunotag™ PPP3R1 Antibody
- Atlas Antibodies Anti-PPP3R1 Antibody
- Creative Diagnostics Anti-PPP3R1 monoclonal antibody, clone 5F2, Anti-PPP3R1 (aa 1-154) polyclonal antibody, and Anti-PPP3R1 polyclonal antibody
-
Custom Antibody ServicesOriGene Antibodies for PPP3R1
- Novus Biologicals Antibodies for PPP3R1
-
Abcam antibodies for PPP3R1
- Invitrogen Antibodies for PPP3R1 (AFLGC-PPP3R1)
-
Boster Bio Antibodies for PPP3R1
-
Santa Cruz Biotechnology (SCBT) Antibodies for PPP3R1
- Sino Biological Antibodies for PPP3R1
Protein Products
-
OriGene Purified Proteins for PPP3R1
- Search Origene for MassSpec and Protein Over-expression Lysates for PPP3R1
- Origene Custom Protein Services for PPP3R1
- Sino Biological Recombinant Proteins for PPP3R1
- Sino Biological Cell Lysates for PPP3R1
- ProSpec Recombinant Proteins for PPP3R1
-
ProSci Proteins for PPP3R1
-
Abcam proteins for PPP3R1
No data available for DME Specific Peptides for PPP3R1 Gene
Domains & Families for PPP3R1 Gene
Gene Families for PPP3R1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Protein Domains for PPP3R1 Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for PPP3R1 Gene
- GenScript: Design optimal peptide antigens:
-
- Protein phosphatase 3 regulatory subunit B alpha isoform 1 (CANB1_HUMAN)
Graphical View of Domain Structure for InterPro Entry
P63098- Family:
-
- Belongs to the calcineurin regulatory subunit family.
Function for PPP3R1 Gene
Molecular function for PPP3R1 Gene
- UniProtKB/Swiss-Prot Function:
- Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.
- GENATLAS Biochemistry:
- calcineurin B,calmodulin dependent protein serine/threonine phosphatase 3,regulatory subunit
Phenotypes From GWAS Catalog for PPP3R1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004723 | calcium-dependent protein serine/threonine phosphatase activity | NAS | 2558868 |
| GO:0005509 | calcium ion binding | NAS,IEA | 2558868 |
| GO:0005515 | protein binding | IPI | 8524402 |
| GO:0005516 | calmodulin binding | NAS | 2558868 |
| GO:0016018 | cyclosporin A binding | IDA | 12218175 |
Phenotypes for PPP3R1 Gene
- MGI mutant phenotypes for PPP3R1:
-
inferred from 4 alleles
- cardiovascular system phenotype
- homeostasis/metabolism phenotype
- nervous system phenotype
- behavior/neurological phenotype
- endocrine/exocrine gland phenotype
- mortality/aging
- cellular phenotype
- embryo phenotype
- renal/urinary system phenotype
- hematopoietic system phenotype
- immune system phenotype
- growth/size/body region phenotype
- GenomeRNAi human phenotypes for PPP3R1:
-
- Condensed cis-Golgi
- Strongly decreased NFAT1-GFP nuclear translocation
- Decreased focal adhesion (FA) area, decreased FA length, decreased FA mean intensity, increased number of small and round FAs, increased FA abundance
- Synthetic lethal with c-Myc after tamoxifen stimulation
- Increased cell migration
- Decreased cell migration
- Decreased viability
- no effect
- shRNA abundance <= 50%
- Lamellipodia cells
Animal Models for PPP3R1 Gene
- MGI Knock Outs for PPP3R1:
-
- Ppp3r1 Ppp3r1<tm2.1Grc>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for PPP3R1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP3R1
- genomics-online: gRNA clones - Search for available PPP3R1 gRNA products
- Overview of 110 available PPP3R1 gene related products
- Applied Biological Materials (abm): CRISPR Clones for PPP3R1 - Select products 50% OFF >
- * PPP3R1 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP3R1 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for PPP3R1
miRNA for PPP3R1 Gene
- miRTarBase miRNAs that target PPP3R1
-
- hsa-mir-30a-5p (MIRT005180)
- hsa-mir-183-5p (MIRT025005)
- hsa-mir-34a-5p (MIRT025426)
- hsa-mir-26b-5p (MIRT029303)
- hsa-mir-24-3p (MIRT030457)
- hsa-mir-532-3p (MIRT037914)
- hsa-mir-5189-3p (MIRT159806)
- hsa-mir-33a-3p (MIRT303230)
- hsa-mir-409-3p (MIRT303233)
- hsa-mir-376a-3p (MIRT439908)
- hsa-mir-369-3p (MIRT439909)
- hsa-mir-20a-5p (MIRT439910)
- hsa-mir-106b-5p (MIRT439911)
- hsa-mir-9-3p (MIRT442615)
- hsa-mir-4714-3p (MIRT442616)
- hsa-mir-656-3p (MIRT442617)
- hsa-mir-6763-3p (MIRT510950)
- hsa-mir-6758-3p (MIRT510951)
- hsa-mir-5587-3p (MIRT510952)
- hsa-mir-4707-5p (MIRT510953)
- hsa-mir-4704-5p (MIRT510954)
- hsa-mir-651-3p (MIRT521719)
- hsa-mir-548as-3p (MIRT521720)
- hsa-mir-548z (MIRT521721)
- hsa-mir-548h-3p (MIRT521722)
- hsa-mir-548d-3p (MIRT521723)
- hsa-mir-548bb-3p (MIRT521724)
- hsa-mir-548ac (MIRT521725)
- hsa-mir-578 (MIRT566293)
- hsa-mir-340-5p (MIRT566294)
- hsa-mir-3185 (MIRT566295)
- hsa-mir-3163 (MIRT566296)
- hsa-mir-5692a (MIRT571779)
- hsa-mir-629-3p (MIRT654811)
- hsa-mir-5006-3p (MIRT654812)
- hsa-mir-4755-5p (MIRT654813)
- hsa-mir-519e-5p (MIRT654814)
- hsa-mir-515-5p (MIRT654815)
- hsa-mir-623 (MIRT654816)
- hsa-mir-6734-3p (MIRT654817)
- hsa-mir-6756-3p (MIRT654818)
- hsa-mir-3127-3p (MIRT654819)
- hsa-mir-211-5p (MIRT654820)
- hsa-mir-204-5p (MIRT654821)
- hsa-mir-519d-3p (MIRT726875)
- hsa-mir-93-5p (MIRT726876)
- hsa-mir-17-5p (MIRT726877)
- hsa-mir-20b-5p (MIRT726878)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP3R1
- Browse OriGene Inhibitory RNA Products For PPP3R1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP3R1
- genomics-online: shRNA clones - Search for available PPP3R1 shRNA products
- Overview of 110 available PPP3R1 gene related products
Clone Products
- Sino Biological Human cDNA Clone for PPP3R1
- Addgene plasmids for PPP3R1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP3R1
- Applied Biological Materials (abm): Clones for PPP3R1 - Select products 50% OFF >
- * PPP3R1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP3R1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Cell Line Products
-
Horizon Cell Lines for PPP3R1
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for PPP3R1 Gene
Localization for PPP3R1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for PPP3R1 Gene
- Cytoplasm, cytosol. Cell membrane. Cell membrane, sarcolemma. Cell membrane; Lipid-anchor. Note=Translocates from the cytosol to the sarcolemma in a CIB1-dependent manner during cardiomyocyte hypertrophy. {ECO:0000250 UniProtKB:Q63810}.
| Compartment | Confidence |
|---|---|
| nucleus | 4 |
| cytosol | 4 |
| plasma membrane | 3 |
| mitochondrion | 2 |
| extracellular | 1 |
| cytoskeleton | 1 |
| endoplasmic reticulum | 1 |
- Cytosol (2)
- Plasma membrane (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0005737 | cytoplasm | IEA | -- |
| GO:0005739 | mitochondrion | IEA | -- |
| GO:0005829 | cytosol | TAS | -- |
| GO:0005886 | plasma membrane | IEA | -- |
Pathways & Interactions for PPP3R1 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Activation of cAMP-Dependent PKA |
Activation of cAMP-Dependent PKA
.77
cAMP Pathway
.77
|
Activation of PKA through GPCR
.71
PKA Signaling
.56
|
| 2 | TCR Signaling (Qiagen) |
PKC-Theta Pathway
.68
TCR Signaling
.68
|
ITK and TCR Signaling
.54
Fc-EpsilonRI Pathway
.49
|
| 3 | CDK-mediated phosphorylation and removal of Cdc6 |
.41
|
.31
|
| 4 | Human cytomegalovirus infection | ||
| 5 | ICos-ICosL Pathway in T-Helper Cell |
CD28 Signaling in T-Helper Cell
.66
ICos-ICosL Pathway in T-Helper Cell
.66
|
Calcium Mediated T-Cell Apoptosis
.31
|
Pathways by source for PPP3R1 Gene
3 Sino Biological pathways for PPP3R1 Gene
4 BioSystems pathways for PPP3R1 Gene
19 Reactome pathways for PPP3R1 Gene
1 PharmGKB pathway for PPP3R1 Gene
29 KEGG pathways for PPP3R1 Gene
4 GeneGo (Thomson Reuters) pathways for PPP3R1 Gene
- Development Role of HDAC and calcium/calmodulin-dependent kinase (CaMK) in control of skeletal myogenesis
- Immune response CD16 signaling in NK cells
- Neurophysiological process Glutamate regulation of Dopamine D1A receptor signaling
- Signal transduction Activation of PKC via G-Protein coupled receptor
4 R&D Systems pathways for PPP3R1 Gene
32 Qiagen pathways for PPP3R1 Gene
- 14-3-3 Induced Apoptosis
- Activation of cAMP-Dependent PKA
- Activation of PKA through GPCR
- BAD Phosphorylation
- Calcium Mediated T-Cell Apoptosis
Interacting Proteins for PPP3R1 Gene
Selected Interacting proteins:
P63098-CANB1_HUMAN
ENSP00000234310
for PPP3R1 Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for PPP3R1
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006470 | protein dephosphorylation | IEA | -- |
| GO:0007223 | Wnt signaling pathway, calcium modulating pathway | TAS | -- |
| GO:0033173 | calcineurin-NFAT signaling cascade | IDA | 22688515 |
| GO:0038095 | Fc-epsilon receptor signaling pathway | TAS | -- |
| GO:0045944 | positive regulation of transcription by RNA polymerase II | IDA | 22688515 |
No data available for SIGNOR curated interactions for PPP3R1 Gene
Drugs & Compounds for PPP3R1 Gene
(2) ApexBio Compounds for PPP3R1 Gene
| Compound | Action | Cas Number |
|---|---|---|
| Cyclosporine | Immunosuppressant drug | 79217-60-0 |
| Pimecrolimus | 137071-32-0 |
Transcripts for PPP3R1 Gene
mRNA/cDNA for PPP3R1 Gene
- (1) REFSEQ mRNAs :
- (6) Additional mRNA sequences :
- (430) Selected AceView cDNA sequences:
- (3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000234310 3024 bps (ENST00000234310.7)
- ENST00000409377 684 bps (ENST00000409377.1)
- ENST00000409752 851 bps (ENST00000409752.5)
CRISPR Products
-
OriGene CRISPR knockouts for PPP3R1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP3R1
- genomics-online: gRNA clones - Search for available PPP3R1 gRNA products
- Overview of 110 available PPP3R1 gene related products
- Applied Biological Materials (abm): CRISPR Clones for PPP3R1 - Select products 50% OFF >
- * PPP3R1 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP3R1 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for PPP3R1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP3R1
- Browse OriGene Inhibitory RNA Products For PPP3R1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP3R1
- genomics-online: shRNA clones - Search for available PPP3R1 shRNA products
- Overview of 110 available PPP3R1 gene related products
Clone Products
- Sino Biological Human cDNA Clone for PPP3R1
- Addgene plasmids for PPP3R1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP3R1
- Applied Biological Materials (abm): Clones for PPP3R1 - Select products 50% OFF >
- * PPP3R1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP3R1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Expression for PPP3R1 Gene
mRNA differential expression in normal tissues according to GTEx for PPP3R1 Gene
This gene is overexpressed in Brain - Frontal Cortex (BA9) (x4.5).
This gene is overexpressed in Brain (24.9) and Fetal Brain (8.5).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PPP3R1 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of PPP3R1 Gene:
PPP3R1SOURCE GeneReport for Unigene cluster for PPP3R1 Gene:
Hs.280604Evidence on tissue expression from TISSUES for PPP3R1 Gene
- Blood(4.4)
- Nervous system(2.9)
- Muscle(2.3)
- Lung(2.2)
- Spleen(2.2)
- Heart(2)
- Liver(2)
Primer Products
-
OriGene qPCR primer pairs for PPP3R1
-
OriGene qPCR primer pairs and template standards for PPP3R1
- genomics-online: primer clones - Search for available PPP3R1 Primer products
- Overview of 110 available PPP3R1 gene related products
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP3R1 Gene
Orthologs for PPP3R1 Gene
This gene was present in the common ancestor of eukaryotes.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | PPP3R1 32 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | -- 33 |
|
ManyToMany | |
| cow (Bos Taurus) |
Mammalia | PPP3R1 33 32 |
|
ManyToMany | |
| WDR92 33 |
|
ManyToMany | |||
| dog (Canis familiaris) |
Mammalia | PPP3R1 32 |
|
||
| -- 33 |
|
OneToMany | |||
| mouse (Mus musculus) |
Mammalia | Ppp3r1 17 33 32 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 33 |
|
ManyToMany | |
| -- 33 |
|
ManyToMany | |||
| rat (Rattus norvegicus) |
Mammalia | Ppp3r1 32 |
|
||
| chicken (Gallus gallus) |
Aves | PPP3R1 33 32 |
|
ManyToMany | |
| WDR92 33 |
|
ManyToMany | |||
| lizard (Anolis carolinensis) |
Reptilia | -- 33 |
|
OneToMany | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | ppp3r1 32 |
|
||
| MGC75600 32 |
|
||||
| zebrafish (Danio rerio) |
Actinopterygii | ppp3r1a 33 32 |
|
ManyToMany | |
| wdr92 33 |
|
ManyToMany | |||
| nrarpa 32 |
|
||||
| fruit fly (Drosophila melanogaster) |
Insecta | CanB 34 |
|
|
|
| CanB2 34 32 |
|
||||
| CG14353 33 |
|
OneToMany | |||
| African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP004298 32 |
|
||
| worm (Caenorhabditis elegans) |
Secernentea | cnb-1 32 |
|
||
| K. lactis yeast (Kluyveromyces lactis) |
Saccharomycetes | KLLA0D02992g 32 |
|
||
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | CNB1 32 |
|
||
| A. gosspyii yeast (Ashbya gossypii) |
Saccharomycetes | AGOS_AER096C 32 |
|
||
| thale cress (Arabidopsis thaliana) |
eudicotyledons | AT3G18430 32 |
|
||
| rice (Oryza sativa) |
Liliopsida | Os08g0442300 32 |
|
||
| fission yeast (Schizosaccharomyces pombe) |
Schizosaccharomycetes | SPCC830.06 32 |
|
||
| bread mold (Neurospora crassa) |
Ascomycetes | NCU03833 32 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 33 |
|
OneToMany | |
| Cin.14820 32 |
|
||||
| sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.14820 32 |
|
- Species where no ortholog for PPP3R1 was found in the sources mined by GeneCards:
-
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for PPP3R1 Gene
- ENSEMBL:
- Gene Tree for PPP3R1 (if available)
- TreeFam:
- Gene Tree for PPP3R1 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for PPP3R1: view image
Paralogs for PPP3R1 Gene
Paralogs for PPP3R1 Gene
(30) SIMAP similar genes for PPP3R1 Gene using alignment to 3 proteins:
- CANB1_HUMAN
- D3YTA9_HUMAN
- F6U1T9_HUMAN
Variants for PPP3R1 Gene
| SNP ID | Clin | Chr 02 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs3039851 | not-provided, not provided | 68,218,182(-) | TTAATTTAA/TTAA/TTAATTTAATTTAA | intron_variant | |
| rs72174030 | not-provided, not provided | 68,252,587(-) | G/GGCGGAGGCGGGGGCGCGCGCGGGCCGGCG | upstream_transcript_variant | |
| rs1000039131 | -- | 68,219,085(-) | A/G | intron_variant | |
| rs1000067912 | -- | 68,210,324(-) | T/C | intron_variant | |
| rs1000104324 | -- | 68,191,306(-) | A/G | intron_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv1072948 | CNV | deletion | 25765185 |
| nsv1126551 | CNV | deletion | 24896259 |
| nsv834251 | CNV | loss | 17160897 |
| nsv953138 | CNV | duplication | 24416366 |
Residual Variation Intolerance Score:
55.3% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for PPP3R1 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- PPP3R1
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP3R1 Gene
Disorders for PPP3R1 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| cervical neuroblastoma |
|
|
| extracranial neuroblastoma |
|
|
| gallbladder small cell carcinoma |
|
|
| ascaridiasis |
|
|
| pre-malignant neoplasm |
|
|
Search PPP3R1 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for PPP3R1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for PPP3R1 Gene
Publications for PPP3R1 Gene
- Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. (PMID: 16209992) Tang W … Ferrell RE (American heart journal 2005) 3 23 43 56
- Isolation and sequence of a cDNA clone for human calcineurin B, the Ca2+-binding subunit of the Ca2+/calmodulin-stimulated protein phosphatase. (PMID: 2558868) Guerini D … Klee CB (DNA (Mary Ann Liebert, Inc.) 1989) 2 3 4 56
- Investigating the human Calcineurin Interaction Network using the πɸLxVP SLiM. (PMID: 27974827) Sheftic SR … Peti W (Scientific reports 2016) 3 4 56
- Cooperative autoinhibition and multi-level activation mechanisms of calcineurin. (PMID: 26794871) Li SJ … Wang ZX (Cell research 2016) 3 4 56
- The molecular mechanism of substrate engagement and immunosuppressant inhibition of calcineurin. (PMID: 23468591) Grigoriu S … Peti W (PLoS biology 2013) 3 4 56
ExternalLinks
Products for PPP3R1 Gene
- Custom Antibody ServicesOriGene Antibodies for PPP3R1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for PPP3R1
- Search Origene for MassSpec and Protein Over-expression Lysates for PPP3R1
- Origene Custom Protein Services for PPP3R1
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP3R1
- Browse OriGene Inhibitory RNA Products For PPP3R1
- OriGene qPCR primer pairs for PPP3R1
- OriGene qPCR primer pairs and template standards for PPP3R1
- OriGene CRISPR knockouts for PPP3R1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For PPP3R1
- Sino Biological Human cDNA Clone for PPP3R1
- Sino Biological Recombinant Proteins for PPP3R1
- Sino Biological Cell Lysates for PPP3R1
- Sino Biological Antibodies for PPP3R1
- Browse Sino Biological Assays
- Browse Recombinant Proteins
- Browse Antibodies
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for PPP3R1
- Novus Biologicals proteins and lysates for PPP3R1
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for PPP3R1
- Abcam proteins for PPP3R1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- ApexBio compounds for PPP3R1
- Addgene plasmids for PPP3R1
- antibodies-online: Show 27 available PPP3R1 Antibodies ranked by validation data
- Compare Top PPP3R1 Antibodies
- antibodies-online: Show 19 available PPP3R1 Elisa Kits ranked by validation data
- Compare Top PPP3R1 Elisa Kits
- antibodies-online: Show 12 available PPP3R1 Proteins ranked by validation data
- Compare Top PPP3R1 Proteins
- Santa Cruz Biotechnology (SCBT) Antibodies for PPP3R1
- Search Santa Cruz Biotechnology (SCBT) for PPP3R1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for PPP3R1
- Search for PPP3R1 Antibodies at ProSci
- Custom Antibody Services
- ProSci Proteins for PPP3R1
- Horizon Cell Lines for PPP3R1
- genomics-online: cdna clones - Search for available PPP3R1 CDNA products
- Overview of 110 available PPP3R1 gene related products
- orf clones - Search for available PPP3R1 ORF products
- Overview of 110 available PPP3R1 gene related products
- genomics-online: gRNA clones - Search for available PPP3R1 gRNA products
- Overview of 110 available PPP3R1 gene related products
- genomics-online: primer clones - Search for available PPP3R1 Primer products
- Overview of 110 available PPP3R1 gene related products
- genomics-online: shRNA clones - Search for available PPP3R1 shRNA products
- Overview of 110 available PPP3R1 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP3R1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP3R1
- Search GeneCopoeia for miRNA 3'UTR Target clone products for PPP3R1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP3R1
- Boster Bio Antibodies for PPP3R1
- Browse Boster Bio ELISA Kits
Sources for PPP3R1 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource