This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the prot... See more...

Aliases for PPP1R15B Gene

Aliases for PPP1R15B Gene

  • Protein Phosphatase 1 Regulatory Subunit 15B 2 3 4 5
  • Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 15B 2 3
  • Protein Phosphatase 1, Regulatory Subunit 15B 2
  • MSSGM2 3
  • CREP 3

External Ids for PPP1R15B Gene

Previous GeneCards Identifiers for PPP1R15B Gene

  • GC01M202101
  • GC01M199833
  • GC01M200736
  • GC01M201552
  • GC01M201549
  • GC01M201104
  • GC01M202639
  • GC01M204372
  • GC01M175537

Summaries for PPP1R15B Gene

Entrez Gene Summary for PPP1R15B Gene

  • This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the protein coding ORF is expressed at high levels in response to stress. Continual translation of the mRNA under conditions of eukaryotic translation initiation factor 2A inactivation is thought to create a feedback loop for reactivation of the gene during recovery from stress. In addition, it has been shown that this protein plays a role in membrane traffic that is independent of translation and that it is required for exocytosis from erythroleukemia cells. Allelic variants of this gene are associated with microcephaly, short stature, and impaired glucose metabolism. [provided by RefSeq, Feb 2016]

GeneCards Summary for PPP1R15B Gene

PPP1R15B (Protein Phosphatase 1 Regulatory Subunit 15B) is a Protein Coding gene. Diseases associated with PPP1R15B include Microcephaly, Short Stature, And Impaired Glucose Metabolism 2 and Primary Microcephaly-Mild Intellectual Disability-Young-Onset Diabetes Syndrome. Gene Ontology (GO) annotations related to this gene include protein serine/threonine phosphatase activity. An important paralog of this gene is PPP1R15A.

UniProtKB/Swiss-Prot Summary for PPP1R15B Gene

  • Maintains low levels of EIF2S1 phosphorylation in unstressed cells by promoting its dephosphorylation by PP1.

Additional gene information for PPP1R15B Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PPP1R15B Gene

Genomics for PPP1R15B Gene

GeneHancer (GH) Regulatory Elements for PPP1R15B Gene

Promoters and enhancers for PPP1R15B Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PPP1R15B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PPP1R15B gene promoter:
  • AP-2alpha
  • AP-2alphaA
  • E2F
  • E2F-1
  • IRF-1
  • Nkx3-1
  • Nkx3-1 v1
  • Nkx3-1 v2
  • Nkx3-1 v3
  • Nkx3-1 v4

Genomic Locations for PPP1R15B Gene

Genomic Locations for PPP1R15B Gene
11,543 bases
Minus strand
8,453 bases
Minus strand

Genomic View for PPP1R15B Gene

Genes around PPP1R15B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP1R15B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP1R15B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PPP1R15B Gene

Proteins for PPP1R15B Gene

  • Protein details for PPP1R15B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein phosphatase 1 regulatory subunit 15B
    Protein Accession:
    Secondary Accessions:
    • Q53GQ4
    • Q658M2
    • Q6P156
    • Q96SN1

    Protein attributes for PPP1R15B Gene

    713 amino acids
    Molecular mass:
    79152 Da
    Quaternary structure:
    • Part of a complex containing PPP1R15B, PP1 and NCK1/2 (By similarity). Interacts with PP1.
    • The phosphatase activity of the PPP1R15B-PP1 complex toward EIF2S1 is specifically inhibited by Salubrinal, a drug that protects cells from endoplasmic reticulum stress.

    Three dimensional structures from OCA and Proteopedia for PPP1R15B Gene

neXtProt entry for PPP1R15B Gene

Post-translational modifications for PPP1R15B Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for PPP1R15B Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for PPP1R15B Gene

Domains & Families for PPP1R15B Gene

Gene Families for PPP1R15B Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for PPP1R15B Gene

Suggested Antigen Peptide Sequences for PPP1R15B Gene

GenScript: Design optimal peptide antigens:
  • Protein phosphatase 1 regulatory subunit 15B (PR15B_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the PPP1R15 family.
  • Belongs to the PPP1R15 family.
genes like me logo Genes that share domains with PPP1R15B: view

Function for PPP1R15B Gene

Molecular function for PPP1R15B Gene

UniProtKB/Swiss-Prot Function:
Maintains low levels of EIF2S1 phosphorylation in unstressed cells by promoting its dephosphorylation by PP1.

Phenotypes From GWAS Catalog for PPP1R15B Gene

Gene Ontology (GO) - Molecular Function for PPP1R15B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 15231748
GO:0019888 protein phosphatase regulator activity IEA,IBA 21873635
genes like me logo Genes that share ontologies with PPP1R15B: view
genes like me logo Genes that share phenotypes with PPP1R15B: view

Human Phenotype Ontology for PPP1R15B Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for PPP1R15B Gene

MGI Knock Outs for PPP1R15B:

Animal Model Products

CRISPR Products

miRNA for PPP1R15B Gene

miRTarBase miRNAs that target PPP1R15B

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP1R15B

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for PPP1R15B Gene

Localization for PPP1R15B Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PPP1R15B gene
Compartment Confidence
endoplasmic reticulum 3
nucleus 2
golgi apparatus 2
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PPP1R15B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000164 protein phosphatase type 1 complex ISS --
GO:0005737 cytoplasm IBA 21873635
GO:0005783 endoplasmic reticulum IBA 21873635
genes like me logo Genes that share ontologies with PPP1R15B: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for PPP1R15B Gene

Pathways & Interactions for PPP1R15B Gene

PathCards logo

SuperPathways for PPP1R15B Gene

No Data Available

Gene Ontology (GO) - Biological Process for PPP1R15B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001933 negative regulation of protein phosphorylation IMP 26307080
GO:0006417 regulation of translation IEA --
GO:0006979 response to oxidative stress IEA --
GO:0006983 ER overload response IEA --
GO:0032516 positive regulation of phosphoprotein phosphatase activity IBA 21873635
genes like me logo Genes that share ontologies with PPP1R15B: view

No data available for Pathways by source and SIGNOR curated interactions for PPP1R15B Gene

Drugs & Compounds for PPP1R15B Gene

No Compound Related Data Available

Transcripts for PPP1R15B Gene

mRNA/cDNA for PPP1R15B Gene

(1) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(290) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP1R15B

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP1R15B Gene

No ASD Table

Relevant External Links for PPP1R15B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PPP1R15B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PPP1R15B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for PPP1R15B Gene

This gene is overexpressed in Pancreatic juice (67.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PPP1R15B Gene

Protein tissue co-expression partners for PPP1R15B Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PPP1R15B Gene:


SOURCE GeneReport for Unigene cluster for PPP1R15B Gene:


Evidence on tissue expression from TISSUES for PPP1R15B Gene

  • Liver(4.4)
  • Stomach(4.3)
  • Eye(4)
  • Nervous system(3.3)
  • Blood(2.8)
  • Intestine(2.4)
genes like me logo Genes that share expression patterns with PPP1R15B: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP1R15B Gene

Orthologs for PPP1R15B Gene

This gene was present in the common ancestor of chordates.

Orthologs for PPP1R15B Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PPP1R15B 33 32
  • 99.39 (n)
(Bos Taurus)
Mammalia PPP1R15B 33 32
  • 82.9 (n)
(Mus musculus)
Mammalia Ppp1r15b 17 33 32
  • 78.33 (n)
(Rattus norvegicus)
Mammalia Ppp1r15b 32
  • 78.09 (n)
(Canis familiaris)
Mammalia PPP1R15B 33 32
  • 77.79 (n)
(Ornithorhynchus anatinus)
Mammalia PPP1R15B 33
  • 56 (a)
(Monodelphis domestica)
Mammalia PPP1R15B 33
  • 45 (a)
(Gallus gallus)
Aves PPP1R15B 33 32
  • 59.47 (n)
(Anolis carolinensis)
Reptilia PPP1R15B 33
  • 59 (a)
(Danio rerio)
Actinopterygii PPP1R15B 33
  • 23 (a)
Species where no ortholog for PPP1R15B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PPP1R15B Gene

Gene Tree for PPP1R15B (if available)
Gene Tree for PPP1R15B (if available)
Evolutionary constrained regions (ECRs) for PPP1R15B: view image

Paralogs for PPP1R15B Gene

Paralogs for PPP1R15B Gene

genes like me logo Genes that share paralogs with PPP1R15B: view

Variants for PPP1R15B Gene

Sequence variations from dbSNP and Humsavar for PPP1R15B Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs759915160 uncertain-significance, Microcephaly, short stature, and impaired glucose metabolism 2 204,411,387(-) G/A/C coding_sequence_variant, missense_variant
rs869025335 pathogenic, Microcephaly, short stature, and impaired glucose metabolism 2, Microcephaly, short stature, and impaired glucose metabolism 2 (MSSGM2) [MIM:616817] 204,406,262(-) G/A/C coding_sequence_variant, intron_variant, missense_variant
rs150224664 uncertain-significance, not provided 204,409,896(-) C/T coding_sequence_variant, missense_variant
rs1558216603 uncertain-significance, not provided 204,410,050(-) ATCCTCAGCTTCCTCATCCCAATCCTCA/ATCCTCA coding_sequence_variant, inframe_deletion
rs1558217471 uncertain-significance, not provided 204,411,020(-) GA/TC coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for PPP1R15B Gene

Variant ID Type Subtype PubMed ID
nsv826409 CNV loss 20364138
nsv952641 CNV duplication 24416366

Variation tolerance for PPP1R15B Gene

Residual Variation Intolerance Score: 29.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.37; 54.02% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PPP1R15B Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP1R15B Gene

Disorders for PPP1R15B Gene

MalaCards: The human disease database

(4) MalaCards diseases for PPP1R15B Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards


  • Microcephaly, short stature, and impaired glucose metabolism 2 (MSSGM2) [MIM:616817]: A disease characterized by microcephaly, mental retardation, short stature, and disturbed glucose metabolism. {ECO:0000269 PubMed:26159176, ECO:0000269 PubMed:26307080}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Note=Defects in PPP1R15B has been found in a patient with isolated coloboma, a defect of the eye characterized by the absence of ocular structures due to abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure). Isolated colobomas may be associated with an abnormally small eye (microphthalmia) or small cornea. {ECO:0000269 PubMed:28493397}.

Additional Disease Information for PPP1R15B

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PPP1R15B: view

No data available for Genatlas for PPP1R15B Gene

Publications for PPP1R15B Gene

  1. Homozygous mutation in the eukaryotic translation initiation factor 2alpha phosphatase gene, PPP1R15B, is associated with severe microcephaly, short stature and intellectual disability. (PMID: 26307080) Kernohan KD … Boycott KM (Human molecular genetics 2015) 3 4 56
  2. A Missense Mutation in PPP1R15B Causes a Syndrome Including Diabetes, Short Stature, and Microcephaly. (PMID: 26159176) Abdulkarim B … Julier C (Diabetes 2015) 3 4 56
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  4. Regulator-driven functional diversification of protein phosphatase-1 in eukaryotic evolution. (PMID: 11948623) Ceulemans H … Bollen M (BioEssays : news and reviews in molecular, cellular and developmental biology 2002) 2 3 56
  5. AP-SWATH Reveals Direct Involvement of VCP/p97 in Integrated Stress Response Signaling Through Facilitating CReP/PPP1R15B Degradation. (PMID: 29599191) Hülsmann J … Meyer H (Molecular & cellular proteomics : MCP 2018) 3 56

Products for PPP1R15B Gene

Sources for PPP1R15B Gene