Free for academic non-profit institutions. Other users need a Commercial license
This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the prot... See more...
Aliases for PPP1R15B Gene
Aliases for PPP1R15B Gene
External Ids for PPP1R15B Gene
- HGNC: 14951
- Entrez Gene: 84919
- Ensembl: ENSG00000158615
- OMIM: 613257
- UniProtKB: Q5SWA1
Previous GeneCards Identifiers for PPP1R15B Gene
- GC01M202101
- GC01M199833
- GC01M200736
- GC01M201552
- GC01M201549
- GC01M201104
- GC01M202639
- GC01M204372
- GC01M175537
Summaries for PPP1R15B Gene
-
This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the protein coding ORF is expressed at high levels in response to stress. Continual translation of the mRNA under conditions of eukaryotic translation initiation factor 2A inactivation is thought to create a feedback loop for reactivation of the gene during recovery from stress. In addition, it has been shown that this protein plays a role in membrane traffic that is independent of translation and that it is required for exocytosis from erythroleukemia cells. Allelic variants of this gene are associated with microcephaly, short stature, and impaired glucose metabolism. [provided by RefSeq, Feb 2016]
GeneCards Summary for PPP1R15B Gene
PPP1R15B (Protein Phosphatase 1 Regulatory Subunit 15B) is a Protein Coding gene. Diseases associated with PPP1R15B include Microcephaly, Short Stature, And Impaired Glucose Metabolism 2 and Primary Microcephaly-Mild Intellectual Disability-Young-Onset Diabetes Syndrome. Gene Ontology (GO) annotations related to this gene include protein serine/threonine phosphatase activity. An important paralog of this gene is PPP1R15A.
UniProtKB/Swiss-Prot Summary for PPP1R15B Gene
-
Maintains low levels of EIF2S1 phosphorylation in unstressed cells by promoting its dephosphorylation by PP1.
Additional gene information for PPP1R15B Gene
- Monarch Initiative
- Search for PPP1R15B at DataMed
- Search for PPP1R15B at HumanCyc
No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PPP1R15B Gene
Genomics for PPP1R15B Gene
GeneHancer (GH) Regulatory Elements for PPP1R15B Gene
Promoters and enhancers for PPP1R15B Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around PPP1R15B on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the PPP1R15B gene promoter:
-
- AP-2alpha
- AP-2alphaA
- E2F
- E2F-1
- IRF-1
- Nkx3-1
- Nkx3-1 v1
- Nkx3-1 v2
- Nkx3-1 v3
- Nkx3-1 v4
Genomic Locations for PPP1R15B Gene
Genomic Locations for PPP1R15B Gene
- chr1:204,400,275-204,411,817
- (GRCh38/hg38)
- Size:
- 11,543 bases
- Orientation:
- Minus strand
- chr1:204,372,492-204,380,944
- (GRCh37/hg19)
- Size:
- 8,453 bases
- Orientation:
- Minus strand
Genomic View for PPP1R15B Gene
Genes around PPP1R15B on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1q32.1 by HGNC
- 1q32.1 by Entrez Gene
- 1q32.1 by Ensembl
PPP1R15B Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for PPP1R15B Gene
Proteins for PPP1R15B Gene
-
Protein details for PPP1R15B Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q5SWA1-PR15B_HUMAN
- Recommended name:
- Protein phosphatase 1 regulatory subunit 15B
- Protein Accession:
- Q5SWA1
- Q53GQ4
- Q658M2
- Q6P156
- Q96SN1
Protein attributes for PPP1R15B Gene
- Size:
- 713 amino acids
- Molecular mass:
- 79152 Da
- Quaternary structure:
-
- Part of a complex containing PPP1R15B, PP1 and NCK1/2 (By similarity). Interacts with PP1.
- Miscellaneous:
-
- The phosphatase activity of the PPP1R15B-PP1 complex toward EIF2S1 is specifically inhibited by Salubrinal, a drug that protects cells from endoplasmic reticulum stress.
Protein Expression for PPP1R15B Gene
Post-translational modifications for PPP1R15B Gene
Other Protein References for PPP1R15B Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Atlas Antibodies Anti-PPP1R15B Antibody
- Creative Diagnostics Anti-PPP1R15B (aa 593-622) polyclonal antibody
-
Custom Antibody ServicesOriGene Antibodies for PPP1R15B
- Novus Biologicals Antibodies for PPP1R15B
-
Abcam antibodies for PPP1R15B
- Invitrogen Antibodies for PPP1R15B (AFLGC-PPP1R15B)
-
Boster Bio Antibodies for PPP1R15B
Protein Products
- Atlas Antibodies PrEST Antigen PPP1R15B
-
OriGene Purified Proteins for PPP1R15B
- Search Origene for MassSpec and Protein Over-expression Lysates for PPP1R15B
- Origene Custom Protein Services for PPP1R15B
No data available for DME Specific Peptides for PPP1R15B Gene
Domains & Families for PPP1R15B Gene
Gene Families for PPP1R15B Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
Protein Domains for PPP1R15B Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for PPP1R15B Gene
- GenScript: Design optimal peptide antigens:
-
- Protein phosphatase 1 regulatory subunit 15B (PR15B_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q5SWA1- Family:
-
- Belongs to the PPP1R15 family.
Function for PPP1R15B Gene
Molecular function for PPP1R15B Gene
- UniProtKB/Swiss-Prot Function:
- Maintains low levels of EIF2S1 phosphorylation in unstressed cells by promoting its dephosphorylation by PP1.
Phenotypes From GWAS Catalog for PPP1R15B Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005515 | protein binding | IPI | 15231748 |
| GO:0019888 | protein phosphatase regulator activity | IEA,IBA | 21873635 |
Phenotypes for PPP1R15B Gene
- MGI mutant phenotypes for PPP1R15B:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for PPP1R15B:
-
- Decreased viability
- Increased shRNA abundance (Z-score > 2)
- Decreased shRNA abundance (Z-score < -2)
- Decreased vesicular stomatitis virus (VSV) infection
- Decreased lymphocytic choriomeningitis virus (LCMV) infection
- Decreased human parainfluenza virus type 3 (HPIV3) infection
- G0/1 arrest
- Decreased cell number
- Decreased POU5F1-GFP protein expression
- Increased cell death HMECs cells
- Negative genetic interaction between BLM-/- and BLM+/+
- Decreased viability of wild-type and TP53 knockout cells, decreased TP53 protein expression ratio (wild-type / TP53 knockout cells)
- Decreased ionizing radiation sensitivity
- Decreased shRNA abundance
- no effect
- Increased vaccinia virus (VACV) infection
- shRNA abundance <= 50%
- Increased viability
Animal Models for PPP1R15B Gene
- MGI Knock Outs for PPP1R15B:
-
- Ppp1r15b Ppp1r15b<tm1Dron>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for PPP1R15B
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP1R15B
- genomics-online: gRNA clones - Search results for available PPP1R15B gene related products
- Applied Biological Materials (abm): CRISPR Clones for PPP1R15B - Select products 50% OFF >
- * PPP1R15B CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP1R15B CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for PPP1R15B
miRNA for PPP1R15B Gene
- miRTarBase miRNAs that target PPP1R15B
-
- hsa-mir-425-5p (MIRT016665)
- hsa-mir-130b-3p (MIRT020212)
- hsa-mir-221-3p (MIRT024204)
- hsa-mir-93-5p (MIRT028000)
- hsa-mir-19b-3p (MIRT031169)
- hsa-mir-615-3p (MIRT039642)
- hsa-mir-186-5p (MIRT045226)
- hsa-mir-1277-5p (MIRT061749)
- hsa-mir-5011-5p (MIRT061755)
- hsa-mir-141-3p (MIRT061757)
- hsa-mir-200a-3p (MIRT061758)
- hsa-mir-510-3p (MIRT061762)
- hsa-mir-3145-3p (MIRT061784)
- hsa-mir-17-5p (MIRT061788)
- hsa-mir-20a-5p (MIRT061789)
- hsa-mir-106a-5p (MIRT061790)
- hsa-mir-130a-3p (MIRT061791)
- hsa-mir-106b-5p (MIRT061793)
- hsa-mir-301a-3p (MIRT061794)
- hsa-mir-20b-5p (MIRT061795)
- hsa-mir-519c-3p (MIRT061796)
- hsa-mir-526b-3p (MIRT061797)
- hsa-mir-519b-3p (MIRT061798)
- hsa-mir-519d-3p (MIRT061799)
- hsa-mir-519a-3p (MIRT061800)
- hsa-mir-454-3p (MIRT061804)
- hsa-mir-301b-3p (MIRT061806)
- hsa-mir-4295 (MIRT061807)
- hsa-mir-3666 (MIRT061808)
- hsa-mir-410-3p (MIRT112223)
- hsa-mir-769-3p (MIRT183607)
- hsa-mir-450b-3p (MIRT183608)
- hsa-mir-590-3p (MIRT183618)
- hsa-mir-512-3p (MIRT247202)
- hsa-mir-944 (MIRT269565)
- hsa-mir-652-5p (MIRT269585)
- hsa-mir-6732-3p (MIRT269589)
- hsa-mir-675-3p (MIRT269603)
- hsa-mir-3929 (MIRT334759)
- hsa-mir-4478 (MIRT334760)
- hsa-mir-4419b (MIRT334761)
- hsa-mir-6074 (MIRT334773)
- hsa-mir-4698 (MIRT334792)
- hsa-mir-6800-3p (MIRT334801)
- hsa-mir-6807-5p (MIRT441870)
- hsa-mir-7641 (MIRT441871)
- hsa-mir-4786-3p (MIRT441872)
- hsa-mir-20b-3p (MIRT441873)
- hsa-mir-3137 (MIRT441874)
- hsa-mir-32-3p (MIRT441875)
- hsa-mir-376a-2-5p (MIRT470402)
- hsa-mir-30e-5p (MIRT470403)
- hsa-mir-30d-5p (MIRT470404)
- hsa-mir-30c-5p (MIRT470405)
- hsa-mir-30b-5p (MIRT470406)
- hsa-mir-30a-5p (MIRT470407)
- hsa-mir-508-3p (MIRT470408)
- hsa-mir-202-3p (MIRT470409)
- hsa-mir-802 (MIRT470410)
- hsa-mir-10b-5p (MIRT470411)
- hsa-mir-10a-5p (MIRT470412)
- hsa-mir-548g-3p (MIRT470413)
- hsa-mir-548av-3p (MIRT470414)
- hsa-let-7a-5p (MIRT470415)
- hsa-let-7i-5p (MIRT470416)
- hsa-let-7b-5p (MIRT470417)
- hsa-let-7f-5p (MIRT470418)
- hsa-let-7c-5p (MIRT470419)
- hsa-let-7g-5p (MIRT470420)
- hsa-mir-4458 (MIRT470421)
- hsa-mir-4500 (MIRT470422)
- hsa-mir-98-5p (MIRT470423)
- hsa-let-7d-5p (MIRT470424)
- hsa-let-7e-5p (MIRT470425)
- hsa-mir-196a-5p (MIRT470426)
- hsa-mir-196b-5p (MIRT470427)
- hsa-mir-4652-3p (MIRT470428)
- hsa-mir-4743-3p (MIRT470429)
- hsa-mir-378a-5p (MIRT470430)
- hsa-mir-582-5p (MIRT470431)
- hsa-mir-101-3p (MIRT470432)
- hsa-mir-638 (MIRT470433)
- hsa-mir-4713-3p (MIRT470434)
- hsa-mir-8077 (MIRT470435)
- hsa-mir-4663 (MIRT470436)
- hsa-mir-4645-3p (MIRT470437)
- hsa-mir-367-5p (MIRT470438)
- hsa-mir-1267 (MIRT470439)
- hsa-mir-29b-1-5p (MIRT470440)
- hsa-mir-4649-3p (MIRT470441)
- hsa-mir-4526 (MIRT470442)
- hsa-mir-3660 (MIRT470443)
- hsa-mir-194-3p (MIRT470444)
- hsa-mir-664a-3p (MIRT470445)
- hsa-mir-329-5p (MIRT470446)
- hsa-mir-6757-3p (MIRT470447)
- hsa-mir-548ah-5p (MIRT470448)
- hsa-mir-3609 (MIRT470449)
- hsa-mir-548t-5p (MIRT470450)
- hsa-mir-548az-5p (MIRT470451)
- hsa-mir-548n (MIRT470452)
- hsa-mir-542-3p (MIRT470453)
- hsa-mir-643 (MIRT470454)
- hsa-mir-621 (MIRT470455)
- hsa-mir-4518 (MIRT470456)
- hsa-mir-1266-5p (MIRT470457)
- hsa-mir-3664-3p (MIRT470458)
- hsa-mir-3146 (MIRT470459)
- hsa-mir-4280 (MIRT470460)
- hsa-mir-142-3p (MIRT470461)
- hsa-mir-548aw (MIRT501522)
- hsa-mir-488-3p (MIRT501523)
- hsa-mir-1468-3p (MIRT501524)
- hsa-mir-548x-5p (MIRT501525)
- hsa-mir-548g-5p (MIRT501526)
- hsa-mir-548f-5p (MIRT501527)
- hsa-mir-548aj-5p (MIRT501528)
- hsa-mir-549a (MIRT501529)
- hsa-mir-3662 (MIRT501530)
- hsa-mir-19a-3p (MIRT501531)
- hsa-mir-4769-5p (MIRT506080)
- hsa-mir-4654 (MIRT506081)
- hsa-mir-7160-5p (MIRT506082)
- hsa-mir-1827 (MIRT506083)
- hsa-mir-2052 (MIRT510955)
- hsa-mir-665 (MIRT521726)
- hsa-mir-566 (MIRT521727)
- hsa-mir-7150 (MIRT521728)
- hsa-mir-6514-3p (MIRT521729)
- hsa-mir-6771-5p (MIRT521730)
- hsa-mir-7977 (MIRT521731)
- hsa-mir-550a-5p (MIRT521732)
- hsa-mir-550a-3-5p (MIRT521733)
- hsa-mir-1271-3p (MIRT521734)
- hsa-mir-4736 (MIRT521735)
- hsa-mir-4763-3p (MIRT521736)
- hsa-mir-1207-5p (MIRT521737)
- hsa-mir-6811-3p (MIRT521738)
- hsa-mir-3665 (MIRT521739)
- hsa-mir-6884-5p (MIRT521740)
- hsa-mir-485-5p (MIRT521741)
- hsa-mir-4679 (MIRT521742)
- hsa-mir-6746-5p (MIRT521743)
- hsa-mir-764 (MIRT521744)
- hsa-mir-5690 (MIRT521745)
- hsa-mir-6513-5p (MIRT535066)
- hsa-mir-887-5p (MIRT535067)
- hsa-mir-3913-5p (MIRT535068)
- hsa-mir-3122 (MIRT535069)
- hsa-mir-450a-1-3p (MIRT535070)
- hsa-mir-6739-5p (MIRT535071)
- hsa-mir-6733-5p (MIRT535072)
- hsa-mir-3153 (MIRT535073)
- hsa-mir-1276 (MIRT535074)
- hsa-mir-498 (MIRT547005)
- hsa-mir-4465 (MIRT547006)
- hsa-mir-26b-5p (MIRT547007)
- hsa-mir-26a-5p (MIRT547008)
- hsa-mir-1297 (MIRT547009)
- hsa-mir-3185 (MIRT547010)
- hsa-mir-4668-3p (MIRT547011)
- hsa-mir-514b-5p (MIRT547012)
- hsa-mir-513c-5p (MIRT547013)
- hsa-mir-4722-5p (MIRT682340)
- hsa-mir-4768-3p (MIRT682341)
- hsa-mir-940 (MIRT682342)
- hsa-mir-6893-5p (MIRT682343)
- hsa-mir-6808-5p (MIRT682344)
- hsa-mir-3927-3p (MIRT767743)
- hsa-mir-6831-5p (MIRT780010)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP1R15B
- Browse OriGene Inhibitory RNA Products For PPP1R15B
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP1R15B
- genomics-online: shRNA clones - Search results for available PPP1R15B gene related products
Clone Products
- Sino Biological Human cDNA Clone for PPP1R15B
- Addgene plasmids for PPP1R15B
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP1R15B
- genomics-online: cdna clones - Search results for available PPP1R15B gene related products
- orf clones - Search results for available PPP1R15B gene related products
- Applied Biological Materials (abm): Clones for PPP1R15B - Select products 50% OFF >
- * PPP1R15B as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP1R15B tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for PPP1R15B Gene
Localization for PPP1R15B Gene
| Compartment | Confidence |
|---|---|
| endoplasmic reticulum | 3 |
| nucleus | 2 |
| golgi apparatus | 2 |
| cytosol | 1 |
- Golgi apparatus (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000164 | protein phosphatase type 1 complex | ISS | -- |
| GO:0005737 | cytoplasm | IBA | 21873635 |
| GO:0005783 | endoplasmic reticulum | IBA | 21873635 |
No data available for Subcellular locations from UniProtKB/Swiss-Prot for PPP1R15B Gene
Pathways & Interactions for PPP1R15B Gene
Interacting Proteins for PPP1R15B Gene
Selected Interacting proteins:
Q5SWA1-PR15B_HUMAN
ENSP00000356156
for PPP1R15B Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for PPP1R15B
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001933 | negative regulation of protein phosphorylation | IMP | 26307080 |
| GO:0006417 | regulation of translation | IEA | -- |
| GO:0006979 | response to oxidative stress | IEA | -- |
| GO:0006983 | ER overload response | IEA | -- |
| GO:0032516 | positive regulation of phosphoprotein phosphatase activity | IBA | 21873635 |
No data available for Pathways by source and SIGNOR curated interactions for PPP1R15B Gene
Drugs & Compounds for PPP1R15B Gene
No Compound Related Data Available
Drug Products
- Atlas Antibodies PrEST Antigen PPP1R15B
Transcripts for PPP1R15B Gene
mRNA/cDNA for PPP1R15B Gene
- (1) REFSEQ mRNAs :
- (8) Additional mRNA sequences :
- (290) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000367188 5259 bps (ENST00000367188.4)
CRISPR Products
-
OriGene CRISPR knockouts for PPP1R15B
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP1R15B
- genomics-online: gRNA clones - Search results for available PPP1R15B gene related products
- Applied Biological Materials (abm): CRISPR Clones for PPP1R15B - Select products 50% OFF >
- * PPP1R15B CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP1R15B CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for PPP1R15B
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP1R15B
- Browse OriGene Inhibitory RNA Products For PPP1R15B
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP1R15B
- genomics-online: shRNA clones - Search results for available PPP1R15B gene related products
Clone Products
- Sino Biological Human cDNA Clone for PPP1R15B
- Addgene plasmids for PPP1R15B
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP1R15B
- genomics-online: cdna clones - Search results for available PPP1R15B gene related products
- orf clones - Search results for available PPP1R15B gene related products
- Applied Biological Materials (abm): Clones for PPP1R15B - Select products 50% OFF >
- * PPP1R15B as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * PPP1R15B tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Expression for PPP1R15B Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Bone (Muscoskeletal System)
This gene is overexpressed in Pancreatic juice (67.6).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PPP1R15B Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of PPP1R15B Gene:
PPP1R15BSOURCE GeneReport for Unigene cluster for PPP1R15B Gene:
Hs.304376Evidence on tissue expression from TISSUES for PPP1R15B Gene
- Liver(4.4)
- Stomach(4.3)
- Eye(4)
- Nervous system(3.3)
- Blood(2.8)
- Intestine(2.4)
Primer Products
-
OriGene qPCR primer pairs for PPP1R15B
-
OriGene qPCR primer pairs and template standards for PPP1R15B
- genomics-online: primer clones - Search results for available PPP1R15B gene related products
Gene Expression Assay Products
No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP1R15B Gene
Orthologs for PPP1R15B Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | PPP1R15B 33 32 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | PPP1R15B 33 32 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Ppp1r15b 17 33 32 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Ppp1r15b 32 |
|
||
| dog (Canis familiaris) |
Mammalia | PPP1R15B 33 32 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | PPP1R15B 33 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | PPP1R15B 33 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | PPP1R15B 33 32 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | PPP1R15B 33 |
|
OneToOne | |
| zebrafish (Danio rerio) |
Actinopterygii | PPP1R15B 33 |
|
OneToOne |
- Species where no ortholog for PPP1R15B was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- tropical clawed frog (Silurana tropicalis)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Evolution for PPP1R15B Gene
- ENSEMBL:
- Gene Tree for PPP1R15B (if available)
- TreeFam:
- Gene Tree for PPP1R15B (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for PPP1R15B: view image
Paralogs for PPP1R15B Gene
Variants for PPP1R15B Gene
| SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs759915160 | uncertain-significance, Microcephaly, short stature, and impaired glucose metabolism 2 | 204,411,387(-) | G/A/C | coding_sequence_variant, missense_variant | |
| rs869025335 | pathogenic, Microcephaly, short stature, and impaired glucose metabolism 2, Microcephaly, short stature, and impaired glucose metabolism 2 (MSSGM2) [MIM:616817] | 204,406,262(-) | G/A/C | coding_sequence_variant, intron_variant, missense_variant | |
| rs150224664 | uncertain-significance, not provided | 204,409,896(-) | C/T | coding_sequence_variant, missense_variant | |
| rs1558216603 | uncertain-significance, not provided | 204,410,050(-) | ATCCTCAGCTTCCTCATCCCAATCCTCA/ATCCTCA | coding_sequence_variant, inframe_deletion | |
| rs1558217471 | uncertain-significance, not provided | 204,411,020(-) | GA/TC | coding_sequence_variant, missense_variant |
Residual Variation Intolerance Score:
29.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
3.37;
54.02% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for PPP1R15B Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP1R15B Gene
Disorders for PPP1R15B Gene
(4) MalaCards diseases for PPP1R15B Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| microcephaly, short stature, and impaired glucose metabolism 2 |
|
|
| primary microcephaly-mild intellectual disability-young-onset diabetes syndrome |
|
|
| epiphyseal dysplasia, multiple, with early-onset diabetes mellitus |
|
|
| microcephaly |
|
|
Search PPP1R15B in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
PR15B_HUMAN- Microcephaly, short stature, and impaired glucose metabolism 2 (MSSGM2) [MIM:616817]: A disease characterized by microcephaly, mental retardation, short stature, and disturbed glucose metabolism. {ECO:0000269 PubMed:26159176, ECO:0000269 PubMed:26307080}. Note=The disease is caused by mutations affecting the gene represented in this entry.
- Note=Defects in PPP1R15B has been found in a patient with isolated coloboma, a defect of the eye characterized by the absence of ocular structures due to abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure). Isolated colobomas may be associated with an abnormally small eye (microphthalmia) or small cornea. {ECO:0000269 PubMed:28493397}.
Additional Disease Information for PPP1R15B
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for PPP1R15B Gene
Publications for PPP1R15B Gene
- Homozygous mutation in the eukaryotic translation initiation factor 2alpha phosphatase gene, PPP1R15B, is associated with severe microcephaly, short stature and intellectual disability. (PMID: 26307080) Kernohan KD … Boycott KM (Human molecular genetics 2015) 3 4 56
- A Missense Mutation in PPP1R15B Causes a Syndrome Including Diabetes, Short Stature, and Microcephaly. (PMID: 26159176) Abdulkarim B … Julier C (Diabetes 2015) 3 4 56
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
- Regulator-driven functional diversification of protein phosphatase-1 in eukaryotic evolution. (PMID: 11948623) Ceulemans H … Bollen M (BioEssays : news and reviews in molecular, cellular and developmental biology 2002) 2 3 56
- AP-SWATH Reveals Direct Involvement of VCP/p97 in Integrated Stress Response Signaling Through Facilitating CReP/PPP1R15B Degradation. (PMID: 29599191) Hülsmann J … Meyer H (Molecular & cellular proteomics : MCP 2018) 3 56
ExternalLinks
Products for PPP1R15B Gene
- Custom Antibody ServicesOriGene Antibodies for PPP1R15B
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for PPP1R15B
- Search Origene for MassSpec and Protein Over-expression Lysates for PPP1R15B
- Origene Custom Protein Services for PPP1R15B
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PPP1R15B
- Browse OriGene Inhibitory RNA Products For PPP1R15B
- OriGene qPCR primer pairs for PPP1R15B
- OriGene qPCR primer pairs and template standards for PPP1R15B
- OriGene CRISPR knockouts for PPP1R15B
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For PPP1R15B
- Sino Biological Human cDNA Clone for PPP1R15B
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for PPP1R15B
- Novus Biologicals proteins and lysates for PPP1R15B
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for PPP1R15B
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for PPP1R15B (AFLGC-PPP1R15B)
- Addgene plasmids for PPP1R15B
- antibodies-online: Show 16 available PPP1R15B Antibodies ranked by validation data
- Compare Top PPP1R15B Antibodies
- antibodies-online: Search results for available PPP1R15B related products ranked by validation data
- antibodies-online: Show 2 available PPP1R15B Proteins ranked by validation data
- Compare Top PPP1R15B Proteins
- genomics-online: cdna clones - Search results for available PPP1R15B gene related products
- orf clones - Search results for available PPP1R15B gene related products
- genomics-online: gRNA clones - Search results for available PPP1R15B gene related products
- genomics-online: primer clones - Search results for available PPP1R15B gene related products
- genomics-online: shRNA clones - Search results for available PPP1R15B gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PPP1R15B
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PPP1R15B
- Search GeneCopoeia for miRNA 3'UTR Target clone products for PPP1R15B
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PPP1R15B
- Boster Bio Antibodies for PPP1R15B
- Browse Boster Bio ELISA Kits
Sources for PPP1R15B Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource