Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PPP1R11 Gene

Aliases for PPP1R11 Gene

  • Protein Phosphatase 1 Regulatory Inhibitor Subunit 11 2 3 5
  • Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 11 2 3
  • Hemochromatosis Candidate Gene V Protein 3 4
  • Protein Phosphatase Inhibitor 3 3 4
  • HCG V 3 4
  • TCTE5 3 4
  • HCGV 3 4
  • Protein Phosphatase 1 Regulatory Subunit 11 3
  • T-Complex-Associated-Testis-Expressed 5 3
  • Inhibitor-3 3
  • CFAP255 3
  • TCTEX5 3
  • HCG-V 3
  • IPP3 3

External Ids for PPP1R11 Gene

Previous HGNC Symbols for PPP1R11 Gene

  • TCTE5

Previous GeneCards Identifiers for PPP1R11 Gene

  • GC06P030090
  • GC06P029805
  • GC06P030141
  • GC06P030142
  • GC06P030037
  • GC06P030038
  • GC06P030047
  • GC06P030192
  • GC06P030242
  • GC06P030272
  • GC06P030362
  • GC06P030512
  • GC06P030717
  • GC06P030881
  • GC06P031035

Summaries for PPP1R11 Gene

Entrez Gene Summary for PPP1R11 Gene

  • This gene encodes a specific inhibitor of protein phosphatase-1 (PP1) with a differential sensitivity toward the metal-independent and metal-dependent forms of PP1. The gene is located within the major histocompatibility complex class I region on chromosome 6. [provided by RefSeq, Jul 2008]

GeneCards Summary for PPP1R11 Gene

PPP1R11 (Protein Phosphatase 1 Regulatory Inhibitor Subunit 11) is a Protein Coding gene. Among its related pathways are Beta-Adrenergic Signaling and Activation of cAMP-Dependent PKA. Gene Ontology (GO) annotations related to this gene include protein phosphatase inhibitor activity.

UniProtKB/Swiss-Prot for PPP1R11 Gene

  • Inhibitor of protein phosphatase 1.

Gene Wiki entry for PPP1R11 Gene

Additional gene information for PPP1R11 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PPP1R11 Gene

Genomics for PPP1R11 Gene

GeneHancer (GH) Regulatory Elements for PPP1R11 Gene

Promoters and enhancers for PPP1R11 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06I030065 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 550.8 +0.1 96 3 ZFP64 DMAP1 YBX1 YY1 SLC30A9 E2F8 ZNF143 ZNF263 SP3 NFYC PPP1R11 HCG4P3 TRIM26 TRIM39 MDC1 PPP1R10 ZNRD1 HLA-A ETF1P1 PAIP1P1
GH06I030094 Enhancer 0.8 ENCODE 10.7 +28.7 28710 1.6 ELF3 FOXA2 MLX ARID4B THRB ZNF48 ZSCAN9 RARA ETS1 ZNF335 HLA-U HLA-K HCG4 ZFP57 PPP1R11 HLA-W TRIM31-AS1 RNF39
GH06I030527 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 3.5 +462.3 462321 3.5 HDGF PKNOX1 FOXA2 MLX ZFP64 ARID4B SIN3A DMAP1 IRF4 YY1 GC06M030528 IER3 PRR3 MICD GNL1 HCG18 ABCF1 HLA-C TRIM39 C6orf136
GH06I030507 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 3.8 +442.9 442900 4 HDGF PKNOX1 IRF4 TCF12 ZNF121 ZNF766 ATF7 RUNX3 JUNB ZNF592 TRIM39-RPP21 HLA-A ABCF1 PPP1R10 TRIM39 HLA-E TRIM26 PPP1R11 PRR3 FLOT1
GH06I029963 Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 2.7 -100.5 -100460 4.8 MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 SP3 HLA-A HLA-K HCG4P3 ZNRD1 HLA-W TRIM39 HLA-H PPP1R10 MDC1 DHX16
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around PPP1R11 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PPP1R11 gene promoter:

Genomic Locations for PPP1R11 Gene

Genomic Locations for PPP1R11 Gene
3,625 bases
Plus strand

Genomic View for PPP1R11 Gene

Genes around PPP1R11 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP1R11 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP1R11 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

Proteins for PPP1R11 Gene

  • Protein details for PPP1R11 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein phosphatase 1 regulatory subunit 11
    Protein Accession:

    Protein attributes for PPP1R11 Gene

    126 amino acids
    Molecular mass:
    13953 Da
    Quaternary structure:
    No Data Available

neXtProt entry for PPP1R11 Gene

Post-translational modifications for PPP1R11 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for PPP1R11 Gene

No data available for DME Specific Peptides for PPP1R11 Gene

Domains & Families for PPP1R11 Gene

Gene Families for PPP1R11 Gene

Protein Domains for PPP1R11 Gene


Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with PPP1R11: view

No data available for UniProtKB/Swiss-Prot for PPP1R11 Gene

Function for PPP1R11 Gene

Molecular function for PPP1R11 Gene

GENATLAS Biochemistry:
protein phosphatase 1,regulatory (inhibitor) subunit 11,t-complex associated, expressed in testis,mouse Tctex 5 homolog,with a calculator mass of 14kDa and an apparent mass of 23kDa
UniProtKB/Swiss-Prot Function:
Inhibitor of protein phosphatase 1.

Phenotypes From GWAS Catalog for PPP1R11 Gene

Gene Ontology (GO) - Molecular Function for PPP1R11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004864 protein phosphatase inhibitor activity IEA --
GO:0004865 protein serine/threonine phosphatase inhibitor activity IEA,IBA --
GO:0005515 protein binding IPI 9843442
GO:0008157 protein phosphatase 1 binding IBA --
GO:0061630 ubiquitin protein ligase activity IDA 27805901
genes like me logo Genes that share ontologies with PPP1R11: view
genes like me logo Genes that share phenotypes with PPP1R11: view

Animal Model Products

miRNA for PPP1R11 Gene

miRTarBase miRNAs that target PPP1R11

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PPP1R11 Gene

Localization for PPP1R11 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PPP1R11 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for PPP1R11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000164 protein phosphatase type 1 complex IBA --
GO:0005634 nucleus IBA --
GO:0005737 cytoplasm ISS --
genes like me logo Genes that share ontologies with PPP1R11: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for PPP1R11 Gene

Pathways & Interactions for PPP1R11 Gene

genes like me logo Genes that share pathways with PPP1R11: view

Pathways by source for PPP1R11 Gene

Gene Ontology (GO) - Biological Process for PPP1R11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0032515 negative regulation of phosphoprotein phosphatase activity IEA,IBA --
GO:0042787 protein ubiquitination involved in ubiquitin-dependent protein catabolic process IMP 27805901
GO:0050710 negative regulation of cytokine secretion ISS --
GO:0050830 defense response to Gram-positive bacterium ISS --
genes like me logo Genes that share ontologies with PPP1R11: view

No data available for SIGNOR curated interactions for PPP1R11 Gene

Drugs & Compounds for PPP1R11 Gene

No Compound Related Data Available

Transcripts for PPP1R11 Gene

mRNA/cDNA for PPP1R11 Gene

(3) REFSEQ mRNAs :
(6) Additional mRNA sequences :
(6) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PPP1R11 Gene

Protein phosphatase 1, regulatory (inhibitor) subunit 11:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP1R11 Gene

No ASD Table

Relevant External Links for PPP1R11 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PPP1R11 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PPP1R11 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for PPP1R11 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (13.7) and CD8 Tcells (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PPP1R11 Gene

Protein tissue co-expression partners for PPP1R11 Gene

NURSA nuclear receptor signaling pathways regulating expression of PPP1R11 Gene:


SOURCE GeneReport for Unigene cluster for PPP1R11 Gene:


mRNA Expression by UniProt/SwissProt for PPP1R11 Gene:

Tissue specificity: Widely expressed.

Evidence on tissue expression from TISSUES for PPP1R11 Gene

  • Nervous system(4.8)
  • Intestine(4.4)
  • Blood(4.2)
  • Skin(3.2)
  • Lung(2.8)
  • Liver(2)
genes like me logo Genes that share expression patterns with PPP1R11: view

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP1R11 Gene

Orthologs for PPP1R11 Gene

This gene was present in the common ancestor of animals.

Orthologs for PPP1R11 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PPP1R11 33 34
  • 99.74 (n)
(Bos Taurus)
Mammalia PPP1R11 33 34
  • 94.18 (n)
(Canis familiaris)
Mammalia PPP1R11 33 34
  • 92.33 (n)
(Rattus norvegicus)
Mammalia Ppp1r11 33
  • 90.74 (n)
(Mus musculus)
Mammalia Ppp1r11 33 16 34
  • 85.71 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 83 (a)
-- 34
  • 81 (a)
-- 34
  • 51 (a)
(Ornithorhynchus anatinus)
Mammalia PPP1R11 34
  • 78 (a)
(Anolis carolinensis)
Reptilia PPP1R11 34
  • 57 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ppp1r11 33
  • 62.85 (n)
Str.2226 33
(Danio rerio)
Actinopterygii ppp1r11 33 34
  • 69.82 (n)
wufj64e04 33
fruit fly
(Drosophila melanogaster)
Insecta CG13994 34
  • 26 (a)
I-3 34
  • 18 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5351 34
  • 35 (a)
Species where no ortholog for PPP1R11 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PPP1R11 Gene

Gene Tree for PPP1R11 (if available)
Gene Tree for PPP1R11 (if available)

Paralogs for PPP1R11 Gene Pseudogenes for PPP1R11 Gene

genes like me logo Genes that share paralogs with PPP1R11: view

No data available for Paralogs for PPP1R11 Gene

Variants for PPP1R11 Gene

Sequence variations from dbSNP and Humsavar for PPP1R11 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000019458 -- 30,068,001(+) T/A intron_variant
rs1000037913 -- 30,065,626(+) A/C upstream_transcript_variant
rs1000494152 -- 30,066,008(+) C/G upstream_transcript_variant
rs1000509720 -- 30,067,149(+) TTTGACGCATTTGGTGCCGTGGAAGGGAAAAAGGGGGACTGCAGTAT/T 5_prime_UTR_variant, frameshift, genic_upstream_transcript_variant, initiator_codon_variant, upstream_transcript_variant
rs1002410977 -- 30,065,515(+) A/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for PPP1R11 Gene

Variant ID Type Subtype PubMed ID
esv2731777 CNV deletion 23290073
esv3411275 CNV duplication 20981092
nsv1074389 CNV deletion 25765185
nsv1122126 CNV deletion 24896259
nsv1144137 CNV deletion 24896259
nsv601264 CNV loss 21841781

Variation tolerance for PPP1R11 Gene

Residual Variation Intolerance Score: 45.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.74; 15.68% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PPP1R11 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP1R11 Gene

Disorders for PPP1R11 Gene

Additional Disease Information for PPP1R11

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for PPP1R11 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for PPP1R11 Gene

Publications for PPP1R11 Gene

  1. Identification and characterization of the human HCG V gene product as a novel inhibitor of protein phosphatase-1. (PMID: 9843442) Zhang J … Lee EY (Biochemistry 1998) 2 3 4 22 58
  2. Cloning of a human homologue of the mouse Tctex-5 gene within the MHC class I region. (PMID: 8781118) Giffon T … David V (Immunogenetics 1996) 2 3 4 58
  3. High-density SNP screening of the major histocompatibility complex in systemic lupus erythematosus demonstrates strong evidence for independent susceptibility regions. (PMID: 19851445) Barcellos LF … Criswell LA (PLoS genetics 2009) 3 44 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. The DNA sequence and analysis of human chromosome 6. (PMID: 14574404) Mungall AJ … Beck S (Nature 2003) 3 4 58

Products for PPP1R11 Gene

Sources for PPP1R11 Gene

Loading form....