Free for academic non-profit institutions. Other users need a Commercial license

Aliases for POTEI Gene

Aliases for POTEI Gene

  • POTE Ankyrin Domain Family Member I 2 3 5
  • POTE Ankyrin Domain Family, Member I 2
  • POTE2beta 3

External Ids for POTEI Gene

Previous GeneCards Identifiers for POTEI Gene

  • GC02M131217

Summaries for POTEI Gene

GeneCards Summary for POTEI Gene

POTEI (POTE Ankyrin Domain Family Member I) is a Protein Coding gene. An important paralog of this gene is POTEE.

Additional gene information for POTEI Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for POTEI Gene

Genomics for POTEI Gene

GeneHancer (GH) Regulatory Elements for POTEI Gene

Promoters and enhancers for POTEI Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02I130509 Promoter 0.5 EPDnew 550.8 0.0 -19 0.1 POTEI ENSG00000274711
GH02I130510 Enhancer 0.4 dbSUPER 0.8 -2.9 -2916 3.6 ZNF781 ZNF697 FAR2P3 FAM168B ENSG00000274711 POTEI
GH02I130516 Enhancer 0.2 dbSUPER 0.4 -7.2 -7245 1.2 ENSG00000274711 GC02P130519 GC02P130520 PIR54921 PIR59676 ENSG00000225819 POTEI
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around POTEI on UCSC Golden Path with GeneCards custom track

Genomic Locations for POTEI Gene

Genomic Locations for POTEI Gene
50,212 bases
Minus strand

Genomic View for POTEI Gene

Genes around POTEI on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
POTEI Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for POTEI Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POTEI Gene

Proteins for POTEI Gene

  • Protein details for POTEI Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    POTE ankyrin domain family member I
    Protein Accession:

    Protein attributes for POTEI Gene

    1075 amino acids
    Molecular mass:
    121282 Da
    Quaternary structure:
    No Data Available

neXtProt entry for POTEI Gene

Post-translational modifications for POTEI Gene

No Post-translational modifications

No data available for DME Specific Peptides for POTEI Gene

Domains & Families for POTEI Gene

Gene Families for POTEI Gene

Suggested Antigen Peptide Sequences for POTEI Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • In the N-terminal section; belongs to the POTE family.
  • In the N-terminal section; belongs to the POTE family.
  • In the C-terminal section; belongs to the actin family.
genes like me logo Genes that share domains with POTEI: view

Function for POTEI Gene

Phenotypes From GWAS Catalog for POTEI Gene

Gene Ontology (GO) - Molecular Function for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with POTEI: view

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for POTEI Gene

Localization for POTEI Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for POTEI gene
Compartment Confidence
extracellular 5
nucleus 2
golgi apparatus 2

Gene Ontology (GO) - Cellular Components for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA,HDA 22664934
GO:0070062 extracellular exosome IDA,HDA 23533145
genes like me logo Genes that share ontologies with POTEI: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for POTEI Gene

Pathways & Interactions for POTEI Gene

SuperPathways for POTEI Gene

No Data Available

Gene Ontology (GO) - Biological Process for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001895 retina homeostasis HEP 23580065
genes like me logo Genes that share ontologies with POTEI: view

No data available for Pathways by source and SIGNOR curated interactions for POTEI Gene

Drugs & Compounds for POTEI Gene

No Compound Related Data Available

Transcripts for POTEI Gene

mRNA/cDNA for POTEI Gene

(9) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for POTEI Gene

POTE ankyrin domain family, member I:
Representative Sequences:

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for POTEI Gene

No ASD Table

Relevant External Links for POTEI Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for POTEI Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for POTEI Gene

mRNA differential expression in normal tissues according to GTEx for POTEI Gene

This gene is overexpressed in Testis (x28.5), Prostate (x7.7), and Heart - Atrial Appendage (x5.5).

Protein differential expression in normal tissues from HIPED for POTEI Gene

This gene is overexpressed in Spleen (19.0), Skin (11.7), Brain (11.2), Heart (8.8), Lung (8.0), and Saliva (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for POTEI Gene

Protein tissue co-expression partners for POTEI Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of POTEI Gene:


SOURCE GeneReport for Unigene cluster for POTEI Gene:

genes like me logo Genes that share expression patterns with POTEI: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for POTEI Gene

Orthologs for POTEI Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for POTEI Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia POTEI 33
  • 98.39 (n)
-- 34
  • 97 (a)
(Rattus norvegicus)
Mammalia Potef 33
  • 85.6 (n)
(Canis familiaris)
Mammalia -- 34
  • 41 (a)
-- 34
  • 38 (a)
-- 34
  • 37 (a)
-- 34
  • 13 (a)
-- 34
  • 11 (a)
-- 34
  • 10 (a)
-- 34
  • 10 (a)
-- 34
  • 8 (a)
(Mus musculus)
Mammalia Gm1758 34
  • 34 (a)
(Bos Taurus)
Mammalia -- 34
  • 10 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 8 (a)
(Gallus gallus)
Aves LOC776816 33
  • 86.13 (n)
-- 34
  • 12 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 37 (a)
(Danio rerio)
Actinopterygii ANKRD7 34
  • 8 (a)
fruit fly
(Drosophila melanogaster)
Insecta Act42A 33
  • 80.04 (n)
(Caenorhabditis elegans)
Secernentea act-5 33
  • 77.6 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons ACT11 33
  • 72.56 (n)
(Oryza sativa)
Liliopsida Os05g0106600 33
  • 73.91 (n)
Species where no ortholog for POTEI was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for POTEI Gene

Gene Tree for POTEI (if available)
Gene Tree for POTEI (if available)

Paralogs for POTEI Gene Pseudogenes for POTEI Gene

genes like me logo Genes that share paralogs with POTEI: view

Variants for POTEI Gene

Sequence variations from dbSNP and Humsavar for POTEI Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs104893611 pathogenic, Heterotaxy, visceral, 2, autosomal 130,597,896(-) G/A genic_upstream_transcript_variant, intron_variant
rs199607550 benign, not specified, not provided 130,598,922(-) T/G genic_upstream_transcript_variant, intron_variant
rs746231039 pathogenic, Heterotaxy, visceral, 2, autosomal 130,593,027(-) G/ genic_upstream_transcript_variant, intron_variant
rs863223280 pathogenic, Heterotaxy, visceral, 2, autosomal 130,597,850(-) GCGCACCCCTGTGCCCACCTGCGC/GCGCACCCCTGTGCCCACCTGCGCACCCCTGTGCCCACCTGCGC genic_upstream_transcript_variant, intron_variant
rs371700198 uncertain-significance, not specified 130,598,685(-) C/A/G genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for POTEI Gene

Variant ID Type Subtype PubMed ID
nsv979262 CNV duplication 23825009
nsv979119 CNV duplication 23825009
nsv963846 CNV duplication 23825009
nsv961646 CNV duplication 23825009
nsv961645 CNV duplication 23825009
nsv953164 CNV deletion 24416366
nsv7327 OTHER inversion 18451855
nsv428403 CNV loss 18775914
nsv1147463 OTHER inversion 26484159
nsv1144914 CNV deletion 24896259
nsv1144913 CNV deletion 24896259
nsv1139735 CNV duplication 24896259
nsv1126565 CNV deletion 24896259
nsv1118877 CNV deletion 24896259
nsv1112770 CNV deletion 24896259
nsv1072977 CNV deletion 25765185
nsv1072976 CNV deletion 25765185
nsv1072030 CNV deletion 25765185
nsv1072029 CNV deletion 25765185
nsv10170 CNV gain+loss 18304495
nsv1005664 CNV loss 25217958
esv3893326 CNV gain 25118596
esv2759092 CNV gain+loss 17122850
dgv2034n106 CNV deletion 24896259
dgv2032n106 OTHER inversion 24896259

Variation tolerance for POTEI Gene

Gene Damage Index Score: 8.15; 84.69% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for POTEI Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POTEI Gene

Disorders for POTEI Gene

Additional Disease Information for POTEI

No disorders were found for POTEI Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for POTEI Gene

Publications for POTEI Gene

  1. Duplication and extensive remodeling shaped POTE family genes encoding proteins containing ankyrin repeat and coiled coil domains. (PMID: 16364570) Hahn Y … Lee B (Gene 2006) 2 3 58
  2. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 58
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 58
  5. In-depth proteomic analyses of exosomes isolated from expressed prostatic secretions in urine. (PMID: 23533145) Principe S … Drake RR (Proteomics 2013) 3 58

Products for POTEI Gene

Sources for POTEI Gene

Loading form....