This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved... See more...

Aliases for POMC Gene

Aliases for POMC Gene

  • Proopiomelanocortin 2 3 5
  • Opiomelanocortin Prepropeptide 2 3
  • Adrenocorticotropic Hormone 2 3
  • Corticotropin-Lipotropin 3 4
  • Pro-Opiomelanocortin 3 4
  • Adrenocorticotropin 2 3
  • Beta-Endorphin 2 3
  • Corticotropin-Like Intermediary Peptide 3
  • Alpha-Melanocyte-Stimulating Hormone 3
  • Alpha-Melanocyte Stimulating Hormone 2
  • Beta-Melanocyte-Stimulating Hormone 3
  • Beta-Melanocyte Stimulating Hormone 2
  • Proopiomelanocortin Preproprotein 3
  • Melanotropin Alpha 3
  • Melanotropin Gamma 3
  • Pro-ACTH-Endorphin 3
  • Melanotropin Beta 3
  • Lipotropin Gamma 3
  • Lipotropin Beta 3
  • Beta-Lipotropin 2
  • Met-Enkephalin 3
  • Alpha-MSH 3
  • Gamma-LPH 3
  • Gamma-MSH 3
  • Beta-LPH 3
  • Beta-MSH 3
  • OBAIRH 3
  • ACTH 3
  • CLIP 3
  • LPH 3
  • MSH 3
  • NPP 3
  • POC 3

External Ids for POMC Gene

Previous GeneCards Identifiers for POMC Gene

  • GC02M025305
  • GC02M025476
  • GC02M025358
  • GC02M025295
  • GC02M025383
  • GC02M025121

Summaries for POMC Gene

Entrez Gene Summary for POMC Gene

  • This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]

GeneCards Summary for POMC Gene

POMC (Proopiomelanocortin) is a Protein Coding gene. Diseases associated with POMC include Obesity, Early-Onset, With Adrenal Insufficiency And Red Hair and Body Mass Index Quantitative Trait Locus 11. Among its related pathways are Cytochrome P450 - arranged by substrate type and Cytokine Signaling in Immune system. Gene Ontology (GO) annotations related to this gene include signaling receptor binding and G protein-coupled receptor binding.

UniProtKB/Swiss-Prot Summary for POMC Gene

  • Corticotropin: Stimulates the adrenal glands to release cortisol.
  • Melanocyte-stimulating hormone alpha: Anorexigenic peptide. Increases the pigmentation of skin by increasing melanin production in melanocytes.
  • Melanocyte-stimulating hormone beta: Increases the pigmentation of skin by increasing melanin production in melanocytes.
  • Beta-endorphin: Endogenous orexigenic opiate.
  • Met-enkephalin: Endogenous opiate.

Tocris Summary for POMC Gene

  • Melanocortin receptors are activated by members of the melanocortin family: alpha-, beta- and gamma-melanocyte stimulating hormone (MSH) and adrenocorticotropic hormone (ACTH). The melanocortins are involved in a range of physiological functions, including pigmentation and inflammation.

Gene Wiki entry for POMC Gene

Additional gene information for POMC Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for POMC Gene

Genomics for POMC Gene

GeneHancer (GH) Regulatory Elements for POMC Gene

Promoters and enhancers for POMC Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J025168 Promoter 0.8 EPDnew Ensembl 750.6 +0.5 502 1.2 EZH2 L3MBTL2 POMC piR-57460-361 FAM228A ADCY3
GH02J025249 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 11.1 -83.1 -83098 4.6 ZBTB40 MLX SMARCE1 RBPJ NR2F1 NR2F6 MIXL1 MYC NFYC L3MBTL2 DNMT3A POMC ADCY3 EFR3B lnc-POMC-2 piR-43105-342
GH02J024970 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 10.8 +196.7 196726 3.7 SIN3A ZBTB40 SP1 ZBTB6 LCORL MLX SMARCE1 RBPJ POLR2A NR2F1 DNAJC27-AS1 DNAJC27 lnc-ADCY3-3 ADCY3 WDCP ASXL2 EFR3B DNMT3A FKBP1B DTNB
GH02J025165 Enhancer 0.6 Ensembl 22.7 +2.6 2603 1.4 CTCF RAD21 MLLT1 RELA TRIM22 ZNF143 IKZF1 SMC3 SMARCA5 EBF1 lnc-DNMT3A-4 piR-57460-361 POMC ADCY3
GH02J025160 Enhancer 0.5 ENCODE 23.3 +7.5 7450 1.4 POLR2A CREM ZFX RUNX3 GABPA ATF2 ZBTB33 POMC lnc-DNMT3A-4 piR-44448
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around POMC on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the POMC gene promoter:
  • CREB
  • deltaCREB
  • STAT3

Genomic Locations for POMC Gene

Genomic Locations for POMC Gene
chr2:25,160,853-25,168,903
(GRCh38/hg38)
Size:
8,051 bases
Orientation:
Minus strand
chr2:25,383,722-25,391,772
(GRCh37/hg19)
Size:
8,051 bases
Orientation:
Minus strand

Genomic View for POMC Gene

Genes around POMC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
POMC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for POMC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POMC Gene

Proteins for POMC Gene

  • Protein details for POMC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P01189-COLI_HUMAN
    Recommended name:
    Pro-opiomelanocortin
    Protein Accession:
    P01189
    Secondary Accessions:
    • P78442
    • Q53T23
    • Q9UD39
    • Q9UD40

    Protein attributes for POMC Gene

    Size:
    267 amino acids
    Molecular mass:
    29424 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for POMC Gene

neXtProt entry for POMC Gene

Post-translational modifications for POMC Gene

  • Specific enzymatic cleavages at paired basic residues yield the different active peptides.
  • O-glycosylated; reducing sugar is probably N-acetylgalactosamine.
  • Glycosylation at Thr71 and Asn91
  • Modification sites at PhosphoSitePlus

Antibody Products

No data available for DME Specific Peptides for POMC Gene

Domains & Families for POMC Gene

Gene Families for POMC Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for POMC Gene

GenScript: Design optimal peptide antigens:
  • Corticotropin-lipotropin (COLI_HUMAN)
  • POMC protein (Q6FHC8_HUMAN)
  • Proopiomelanocortin (Q6LDP0_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P01189

UniProtKB/Swiss-Prot:

COLI_HUMAN :
  • Belongs to the POMC family.
Family:
  • Belongs to the POMC family.
genes like me logo Genes that share domains with POMC: view

Function for POMC Gene

Molecular function for POMC Gene

UniProtKB/Swiss-Prot Function:
Corticotropin: Stimulates the adrenal glands to release cortisol.
UniProtKB/Swiss-Prot Function:
Melanocyte-stimulating hormone alpha: Anorexigenic peptide. Increases the pigmentation of skin by increasing melanin production in melanocytes.
UniProtKB/Swiss-Prot Function:
Melanocyte-stimulating hormone beta: Increases the pigmentation of skin by increasing melanin production in melanocytes.
UniProtKB/Swiss-Prot Function:
Beta-endorphin: Endogenous orexigenic opiate.
UniProtKB/Swiss-Prot Function:
Met-enkephalin: Endogenous opiate.
GENATLAS Biochemistry:
proopio-melanocortin (adrenocorticotropin/ beta-lipotropin)

Phenotypes From GWAS Catalog for POMC Gene

Gene Ontology (GO) - Molecular Function for POMC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001664 G protein-coupled receptor binding IDA 19452503
GO:0005102 signaling receptor binding IMP 9620771
GO:0005179 hormone activity ISS --
GO:0031781 type 3 melanocortin receptor binding IPI 19743876
GO:0031782 type 4 melanocortin receptor binding IPI 19743876
genes like me logo Genes that share ontologies with POMC: view
genes like me logo Genes that share phenotypes with POMC: view

Human Phenotype Ontology for POMC Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for POMC Gene

MGI Knock Outs for POMC:

Animal Model Products

CRISPR Products

miRNA for POMC Gene

miRTarBase miRNAs that target POMC

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for POMC Gene

Localization for POMC Gene

Subcellular locations from UniProtKB/Swiss-Prot for POMC Gene

Secreted. Note=Melanocyte-stimulating hormone alpha and beta-endorphin are stored in separate granules in hypothalamic POMC neurons, suggesting that secretion may be under the control of different regulatory mechanisms. {ECO:0000250 UniProtKB:P01193}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for POMC gene
Compartment Confidence
extracellular 5
peroxisome 5
mitochondrion 3
nucleus 3
plasma membrane 2
cytoskeleton 2
endoplasmic reticulum 2
cytosol 2
lysosome 2
golgi apparatus 2
endosome 1

Gene Ontology (GO) - Cellular Components for POMC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space IBA,IDA 9620771
GO:0005737 cytoplasm ISS --
GO:0030141 secretory granule ISS --
GO:0034774 secretory granule lumen TAS --
genes like me logo Genes that share ontologies with POMC: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for POMC Gene

Pathways & Interactions for POMC Gene

genes like me logo Genes that share pathways with POMC: view

SIGNOR curated interactions for POMC Gene

Activates:
Inactivates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for POMC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006091 generation of precursor metabolites and energy IMP 9620771
GO:0007165 signal transduction IMP 9620771
GO:0007186 G protein-coupled receptor signaling pathway TAS --
GO:0007218 neuropeptide signaling pathway IEA --
GO:0007267 cell-cell signaling IMP 9620771
genes like me logo Genes that share ontologies with POMC: view

Drugs & Compounds for POMC Gene

(107) Drugs for POMC Gene - From: DrugBank, ClinicalTrials, ApexBio, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Loperamide Approved Pharma Target, modulator 162
dihydromorphine Experimental, Illicit Pharma Full agonist, Agonist, Partial agonist, Target, agonist 0
Etorphine Illicit, Vet_approved Pharma Full agonist, Agonist, Target 0
Adrenocorticotropic Hormone Pharma 207
Aluminum hydroxide, magnesium hydroxide, simethicone drug combination Pharma 53

(42) Additional Compounds for POMC Gene - From: Novoseek and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
[Nle4,D-Phe7]-alpha-MSH
75921-69-6
Melanocyte-stimulating hormone release inhibiting factor
2002-44-0

(5) Tocris Compounds for POMC Gene

Compound Action Cas Number
[Nle4,D-Phe7]-alpha-MSH Melanocortin receptor agonist 75921-69-6
alpha-MSH Endogenous melanocortin receptor agonist 581-05-5
Melanocyte-stimulating hormone release inhibiting factor Inhibitor of alpha-MSH release; inhibits opioid effects in vivo 2002-44-0
Melanotan II High affinity melanocortin receptor agonist 121062-08-6
THIQ Potent and selective MC4 receptor agonist 312637-48-2

(1) ApexBio Compounds for POMC Gene

Compound Action Cas Number
Beta-Lipotropin (1-10), porcine Morphine-like substance 77875-68-4
genes like me logo Genes that share compounds with POMC: view

Transcripts for POMC Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for POMC Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4
SP1:
SP2: -
SP3: - -
SP4: -

Relevant External Links for POMC Gene

GeneLoc Exon Structure for
POMC
ECgene alternative splicing isoforms for
POMC

Expression for POMC Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for POMC Gene

mRNA differential expression in normal tissues according to GTEx for POMC Gene

This gene is overexpressed in Pituitary (x52.5).

Protein differential expression in normal tissues from HIPED for POMC Gene

This gene is overexpressed in Urine (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for POMC Gene



Protein tissue co-expression partners for POMC Gene

NURSA nuclear receptor signaling pathways regulating expression of POMC Gene:

POMC

SOURCE GeneReport for Unigene cluster for POMC Gene:

Hs.1897

mRNA Expression by UniProt/SwissProt for POMC Gene:

P01189-COLI_HUMAN
Tissue specificity: ACTH and MSH are produced by the pituitary gland.

Evidence on tissue expression from TISSUES for POMC Gene

  • Nervous system(4.8)
  • Adrenal gland(4)
  • Blood(3.7)
  • Thyroid gland(2.6)
  • Skin(2.5)
  • Urine(2.5)
  • Heart(2.4)
  • Pancreas(2.4)
  • Liver(2.2)
  • Kidney(2.1)
  • Muscle(2.1)
  • Intestine(2)
  • Lung(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for POMC Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • ear
  • eye
  • head
  • mouth
Thorax:
  • esophagus
  • heart
Abdomen:
  • abdominal wall
  • adrenal gland
  • biliary tract
  • gallbladder
  • intestine
  • large intestine
  • liver
  • pancreas
  • small intestine
  • spleen
  • stomach
Pelvis:
  • ovary
  • penis
  • testicle
  • uterus
General:
  • blood
  • blood vessel
  • hair
  • lymph node
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with POMC: view

Orthologs for POMC Gene

This gene was present in the common ancestor of chordates.

Orthologs for POMC Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia POMC 33 32
  • 98.88 (n)
OneToOne
dog
(Canis familiaris)
Mammalia POMC 33 32
  • 87.15 (n)
OneToOne
cow
(Bos Taurus)
Mammalia POMC 33 32
  • 86.56 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Pomc 32
  • 83.83 (n)
mouse
(Mus musculus)
Mammalia Pomc 17 33 32
  • 82.7 (n)
oppossum
(Monodelphis domestica)
Mammalia POMC 33
  • 54 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia POMC 33
  • 50 (a)
OneToOne
chicken
(Gallus gallus)
Aves POMC 33 32
  • 67.99 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia POMC 33
  • 47 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia pomc 32
  • 63.4 (n)
zebrafish
(Danio rerio)
Actinopterygii pomca 33 32
  • 60 (n)
OneToMany
pomcb 33
  • 35 (a)
OneToMany
pomc 32
Species where no ortholog for POMC was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for POMC Gene

ENSEMBL:
Gene Tree for POMC (if available)
TreeFam:
Gene Tree for POMC (if available)
Aminode:
Evolutionary constrained regions (ECRs) for POMC: view image

Paralogs for POMC Gene

(1) SIMAP similar genes for POMC Gene using alignment to 19 proteins:

  • COLI_HUMAN
  • E9PHK5_HUMAN
  • K7QX41_HUMAN
  • K7QX44_HUMAN
  • K7QX47_HUMAN
  • K7QX51_HUMAN
  • K7QZC2_HUMAN
  • K7QZC9_HUMAN
  • K7QZD2_HUMAN
  • K7R2I7_HUMAN
  • K7R2J5_HUMAN
  • K7R8V2_HUMAN
  • K7R8V7_HUMAN
  • K7R8W0_HUMAN
  • K7RMD8_HUMAN
  • K7RME8_HUMAN
  • K7RMF2_HUMAN
  • Q6FHC8_HUMAN
  • Q6LDP0_HUMAN
genes like me logo Genes that share paralogs with POMC: view

No data available for Paralogs for POMC Gene

Variants for POMC Gene

Sequence variations from dbSNP and Humsavar for POMC Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1042571 likely-benign, Monogenic Non-Syndromic Obesity, Proopiomelanocortin deficiency 25,161,018(-) G/A 3_prime_UTR_variant
rs10654394 benign-likely-benign, likely-benign, not specified, Monogenic Non-Syndromic Obesity, Proopiomelanocortin deficiency 25,161,588(-) GCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGC/GCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGC coding_sequence_variant, inframe_deletion, inframe_insertion
rs121918111 pathogenic, Proopiomelanocortin deficiency 25,161,572(-) C/A/G/T coding_sequence_variant, missense_variant, stop_gained
rs121918112 pathogenic, Proopiomelanocortin deficiency 25,161,734(-) T/A coding_sequence_variant, stop_gained
rs139229417 uncertain-significance, Monogenic Non-Syndromic Obesity, Proopiomelanocortin deficiency 25,168,630(-) T/C 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for POMC Gene

Variant ID Type Subtype PubMed ID
dgv57n68 CNV loss 17160897
esv33372 CNV loss 17666407
nsv1008732 CNV loss 25217958

Variation tolerance for POMC Gene

Residual Variation Intolerance Score: 62.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.53; 72.01% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for POMC Gene

Human Gene Mutation Database (HGMD)
POMC
SNPedia medical, phenotypic, and genealogical associations of SNPs for
POMC

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POMC Gene

Disorders for POMC Gene

MalaCards: The human disease database

(193) MalaCards diseases for POMC Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search POMC in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

COLI_HUMAN
  • Obesity (OBESITY) [MIM:601665]: A condition characterized by an increase of body weight beyond the limitation of skeletal and physical requirements, as the result of excessive accumulation of body fat. {ECO:0000269 PubMed:12165561}. Note=Disease susceptibility may be associated with variations affecting the gene represented in this entry.
  • Obesity, early-onset, with adrenal insufficiency and red hair (OBAIRH) [MIM:609734]: An autosomal recessive disorder characterized by early-onset obesity due to severe hyperphagia, pigmentary abnormalities, mainly pale skin and red hair, and secondary hypocortisolism. {ECO:0000269 PubMed:9620771}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for POMC Gene

early-onset obesity,adrenal insufficiency and red hair pigmentation

Additional Disease Information for POMC

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with POMC: view

Publications for POMC Gene

  1. Molecular screening of the proopiomelanocortin (POMC ) gene in Italian obese children: report of three new mutations. (PMID: 11244459) Miraglia del Giudice E … Perrone L (International journal of obesity and related metabolic disorders : journal of the International Association for the Study of Obesity 2001) 3 4 23 43 56
  2. Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. (PMID: 9620771) Krude H … Grüters A (Nature genetics 1998) 2 3 4 23 56
  3. Colon tumor mutations and epigenetic changes associated with genetic polymorphism: insight into disease pathways. (PMID: 18992263) Slattery ML … Samowitz WS (Mutation research 2009) 3 23 43 56
  4. Mutational analysis of the pro-opiomelanocortin gene in French obese children led to the identification of a novel deleterious heterozygous mutation located in the alpha-melanocyte stimulating hormone domain. (PMID: 18091355) Dubern B … Clement K (Pediatric research 2008) 3 23 43 56
  5. Polymorphisms in genes regulating the HPA axis associated with empirically delineated classes of unexplained chronic fatigue. (PMID: 16610949) Smith AK … Rajeevan MS (Pharmacogenomics 2006) 3 23 43 56

Products for POMC Gene

Sources for POMC Gene