Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PITX1 Gene

Aliases for PITX1 Gene

  • Paired Like Homeodomain 1 2 3 5
  • Paired-Like Homeodomain Transcription Factor 1 2 3 4
  • Homeobox Protein PITX1 3 4
  • PTX1 3 4
  • BFT 3 4
  • Hindlimb Expressed Homeobox Protein Backfoot 3
  • Hindlimb-Expressed Homeobox Protein Backfoot 4
  • Pituitary Otx-Related Factor 3
  • Paired-Like Homeodomain 1 2
  • Pituitary Homeo Box 1 3
  • Pituitary Homeobox 1 3
  • LBNBG 3
  • POTX 3
  • CCF 3

External Ids for PITX1 Gene

Previous HGNC Symbols for PITX1 Gene

  • BFT

Previous GeneCards Identifiers for PITX1 Gene

  • GC05M134015
  • GC05M134930
  • GC05M134394
  • GC05M134439
  • GC05M134391
  • GC05M129551
  • GC05M134363

Summaries for PITX1 Gene

Entrez Gene Summary for PITX1 Gene

  • This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]

GeneCards Summary for PITX1 Gene

PITX1 (Paired Like Homeodomain 1) is a Protein Coding gene. Diseases associated with PITX1 include Clubfoot, Congenital, With Or Without Deficiency Of Long Bones And/Or Mirror-Image Polydactyly and Liebenberg Syndrome. Among its related pathways are DAG and IP3 signaling. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcriptional activator activity, RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is PITX2.

UniProtKB/Swiss-Prot for PITX1 Gene

  • Sequence-specific transcription factor that binds gene promoters and activates their transcription. May play a role in the development of anterior structures, and in particular, the brain and facies and in specifying the identity or structure of hindlimb.

Gene Wiki entry for PITX1 Gene

Additional gene information for PITX1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PITX1 Gene

Genomics for PITX1 Gene

GeneHancer (GH) Regulatory Elements for PITX1 Gene

Promoters and enhancers for PITX1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J135026 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 663.2 +3.8 3806 9.3 HDGF PKNOX1 ZFP64 ARID4B SIN3A FEZF1 ZNF2 POLR2B ZNF213 E2F8 PITX1 C5orf66-AS1 C5orf66 ENSG00000277619 CATSPER3
GH05J135039 Promoter/Enhancer 0.9 EPDnew dbSUPER 650.7 -4.9 -4947 0.1 SUZ12 EZH2 C5orf66-AS1 PITX1 C5orf66
GH05J135137 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 16.1 -105.2 -105229 5.9 PKNOX1 FOXA2 ARNT BRCA1 YY1 GLIS2 FOS ATF7 DEK SP5 SMAD5 PITX1 DDX46 CATSPER3 LOC105379188 ENSG00000248753 C5orf66 C5orf66-AS2
GH05J135024 Enhancer 0.9 ENCODE dbSUPER 12 +9.4 9384 1.5 MEIS2 TFAP4 PKNOX1 ATF1 JUN ZIC2 RAD21 THRB FOSL1 GATA3 C5orf66-AS1 PITX1 C5orf66 CATSPER3
GH05J135014 Enhancer 0.8 ENCODE dbSUPER 12.6 +20.4 20407 0.2 FOXA2 NFIA RXRA RAD21 SP1 JUND GATA3 ESR1 HNF4A PITX1 C5orf66-AS1 C5orf66 CATSPER3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PITX1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PITX1 gene promoter:
  • AP-1
  • c-Jun
  • ATF-2
  • c-Fos
  • E2F-1
  • E2F-5
  • E2F-3a
  • E2F-2

Genomic Locations for PITX1 Gene

Genomic Locations for PITX1 Gene
chr5:135,027,734-135,034,813
(GRCh38/hg38)
Size:
7,080 bases
Orientation:
Minus strand
chr5:134,363,424-134,370,503
(GRCh37/hg19)
Size:
7,080 bases
Orientation:
Minus strand

Genomic View for PITX1 Gene

Genes around PITX1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PITX1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PITX1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PITX1 Gene

Proteins for PITX1 Gene

  • Protein details for PITX1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P78337-PITX1_HUMAN
    Recommended name:
    Pituitary homeobox 1
    Protein Accession:
    P78337
    Secondary Accessions:
    • A8K3M0
    • D3DQB0
    • O14677
    • O60425
    • Q9BTI5

    Protein attributes for PITX1 Gene

    Size:
    314 amino acids
    Molecular mass:
    34128 Da
    Quaternary structure:
    • Interacts with POU1F1 (PubMed:26612202).

neXtProt entry for PITX1 Gene

Post-translational modifications for PITX1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for PITX1 Gene

No data available for DME Specific Peptides for PITX1 Gene

Domains & Families for PITX1 Gene

Gene Families for PITX1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for PITX1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P78337

UniProtKB/Swiss-Prot:

PITX1_HUMAN :
  • Belongs to the paired homeobox family. Bicoid subfamily.
Family:
  • Belongs to the paired homeobox family. Bicoid subfamily.
genes like me logo Genes that share domains with PITX1: view

Function for PITX1 Gene

Molecular function for PITX1 Gene

UniProtKB/Swiss-Prot Function:
Sequence-specific transcription factor that binds gene promoters and activates their transcription. May play a role in the development of anterior structures, and in particular, the brain and facies and in specifying the identity or structure of hindlimb.
GENATLAS Biochemistry:
POU domain,class 1,transcription factor 3,mammalian homeo box backfoot,Drosophila bicoid related,mapping in TCOF1 region and possibly involved in the syndrome,expressed in Rathke pouch at an early stage of pituitary development in a subset of adult anterior pituitary cells that express POMC,and in craniofacial development

Phenotypes From GWAS Catalog for PITX1 Gene

Gene Ontology (GO) - Molecular Function for PITX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding NAS 19274049
GO:0001077 transcriptional activator activity, RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0001085 RNA polymerase II transcription factor binding IPI 26612202
GO:0001190 transcriptional activator activity, RNA polymerase II transcription factor binding IEA --
genes like me logo Genes that share ontologies with PITX1: view
genes like me logo Genes that share phenotypes with PITX1: view

Human Phenotype Ontology for PITX1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for PITX1 Gene

MGI Knock Outs for PITX1:

Animal Model Products

Targeted motifs for PITX1 Gene
HOMER Transcription Factor Regulatory Elements motif PITX1
  • Consensus sequence: TAATCCCN Submotif: canonical Cell Type: Chicken GEO ID: GSE38910

Clone Products

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for PITX1 Gene

Localization for PITX1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PITX1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PITX1 gene
Compartment Confidence
nucleus 5
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for PITX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA,IEA 17984056
GO:0005667 transcription factor complex IEA --
GO:0005730 nucleolus IDA --
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with PITX1: view

Pathways & Interactions for PITX1 Gene

genes like me logo Genes that share pathways with PITX1: view

Pathways by source for PITX1 Gene

1 GeneGo (Thomson Reuters) pathway for PITX1 Gene

Gene Ontology (GO) - Biological Process for PITX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001501 skeletal system development TAS 9070926
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006366 transcription by RNA polymerase II IEA --
GO:0007275 multicellular organism development IEA --
genes like me logo Genes that share ontologies with PITX1: view

No data available for SIGNOR curated interactions for PITX1 Gene

Drugs & Compounds for PITX1 Gene

(3) Additional Compounds for PITX1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with PITX1: view

Transcripts for PITX1 Gene

mRNA/cDNA for PITX1 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(162) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PITX1 Gene

Paired-like homeodomain 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PITX1 Gene

No ASD Table

Relevant External Links for PITX1 Gene

GeneLoc Exon Structure for
PITX1
ECgene alternative splicing isoforms for
PITX1

Expression for PITX1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PITX1 Gene

mRNA differential expression in normal tissues according to GTEx for PITX1 Gene

This gene is overexpressed in Esophagus - Mucosa (x23.8), Pituitary (x6.5), Vagina (x5.9), and Minor Salivary Gland (x4.7).

Protein differential expression in normal tissues from HIPED for PITX1 Gene

This gene is overexpressed in Pancreatic juice (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PITX1 Gene



Protein tissue co-expression partners for PITX1 Gene

NURSA nuclear receptor signaling pathways regulating expression of PITX1 Gene:

PITX1

SOURCE GeneReport for Unigene cluster for PITX1 Gene:

Hs.84136

Evidence on tissue expression from TISSUES for PITX1 Gene

  • Pancreas(4.1)
  • Muscle(2.7)
  • Intestine(2.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for PITX1 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • integumentary
  • nervous
  • skeleton
Regions:
Head and neck:
  • brain
  • head
  • skull
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • shoulder
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • skin
genes like me logo Genes that share expression patterns with PITX1: view

No data available for mRNA Expression by UniProt/SwissProt for PITX1 Gene

Orthologs for PITX1 Gene

This gene was present in the common ancestor of animals.

Orthologs for PITX1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PITX1 34 33
  • 99.79 (n)
OneToOne
dog
(Canis familiaris)
Mammalia PITX1 34 33
  • 95.53 (n)
OneToOne
cow
(Bos Taurus)
Mammalia PITX1 34 33
  • 94.16 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Pitx1 16 34 33
  • 91.3 (n)
rat
(Rattus norvegicus)
Mammalia Pitx1 33
  • 90.76 (n)
oppossum
(Monodelphis domestica)
Mammalia PITX1 34
  • 88 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia PITX1 34
  • 82 (a)
OneToOne
chicken
(Gallus gallus)
Aves PITX1 34 33
  • 80.02 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia PITX1 34
  • 64 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia pitx1 33
  • 77.81 (n)
African clawed frog
(Xenopus laevis)
Amphibia pitx1 33
zebrafish
(Danio rerio)
Actinopterygii pitx1 34 33
  • 76.86 (n)
OneToOne
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.5257 33
fruit fly
(Drosophila melanogaster)
Insecta Ptx1 34 35
  • 20 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea unc-30 34
  • 29 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 27 (a)
OneToMany
Species where no ortholog for PITX1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PITX1 Gene

ENSEMBL:
Gene Tree for PITX1 (if available)
TreeFam:
Gene Tree for PITX1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PITX1: view image

Paralogs for PITX1 Gene

Paralogs for PITX1 Gene

(14) SIMAP similar genes for PITX1 Gene using alignment to 4 proteins:

  • PITX1_HUMAN
  • D6R955_HUMAN
  • D6R9U1_HUMAN
  • H0YJC8_HUMAN
genes like me logo Genes that share paralogs with PITX1: view

Variants for PITX1 Gene

Sequence variations from dbSNP and Humsavar for PITX1 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs121909109 pathogenic, Talipes equinovarus, Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly (CCF) [MIM:119800] 135,031,290(-) C/T coding_sequence_variant, missense_variant
rs730882191 pathogenic, Talipes equinovarus 135,028,925(-) GAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCCGAGT/GAGT coding_sequence_variant, frameshift
rs1057523765 likely-pathogenic, not provided 135,031,510(-) T/C splice_acceptor_variant
rs200888898 uncertain-significance, not specified 135,031,416(-) T/G coding_sequence_variant, missense_variant
rs201133610 uncertain-significance, not specified 135,031,427(-) G/T coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for PITX1 Gene

Variant ID Type Subtype PubMed ID
dgv969n67 CNV gain 20364138
nsv1073498 CNV deletion 25765185
nsv462458 CNV loss 19166990
nsv599744 CNV loss 21841781
nsv823239 CNV gain 20364138
nsv823240 CNV gain 20364138
nsv823243 CNV gain 20364138
nsv830495 CNV loss 17160897

Variation tolerance for PITX1 Gene

Residual Variation Intolerance Score: 36% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.64; 91.36% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PITX1 Gene

Human Gene Mutation Database (HGMD)
PITX1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PITX1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PITX1 Gene

Disorders for PITX1 Gene

MalaCards: The human disease database

(11) MalaCards diseases for PITX1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search PITX1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

PITX1_HUMAN
  • Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly (CCF) [MIM:119800]: A congenital limb deformity defined as fixation of the foot in cavus, adductus, varus, and equinus (i.e., inclined inwards, axially rotated outwards, and pointing downwards) with concomitant soft tissue abnormalities. Clubfoot may occur in isolation or as part of a syndrome. Some patients present tibial hemimelia, bilateral patellar hypoplasia, and preaxial mirror-image polydactyly. {ECO:0000269 PubMed:18950742, ECO:0000269 PubMed:22258522}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Liebenberg syndrome (LBNBG) [MIM:186550]: An upper limb-malformation syndrome characterized by the combination of dysplastic elbow joints and the fusion of wrist bones with consequent radial deviation. {ECO:0000269 PubMed:23022097}. Note=The gene represented in this entry is involved in disease pathogenesis. A chromosomal aberration involving the PITX1 locus results in LBNBG. Translocation t(5;18)(q31.1;q12.3). Additionally, two chromosome 5 deletions located 5of PITX1 have been found in LBNBG patients. These structural variations cause altered expression of PITX1 in the forelimb via the activation of ectopic enhancers (PubMed:23022097). {ECO:0000269 PubMed:23022097}.

Additional Disease Information for PITX1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PITX1: view

No data available for Genatlas for PITX1 Gene

Publications for PITX1 Gene

  1. Human and murine PTX1/Ptx1 gene maps to the region for Treacher Collins syndrome. (PMID: 9337397) Crawford MJ … Drouin J (Mammalian genome : official journal of the International Mammalian Genome Society 1997) 2 3 4 22 58
  2. Backfoot, a novel homeobox gene, maps to human chromosome 5 (BFT) and mouse chromosome 13 (Bft). (PMID: 9070926) Shang J … Francke U (Genomics 1997) 2 3 4 58
  3. Functional characterization of a human POU1F1 mutation associated with isolated growth hormone deficiency: a novel etiology for IGHD. (PMID: 26612202) Sobrier ML … Amselem S (Human molecular genetics 2016) 3 4 58
  4. Deletions in PITX1 cause a spectrum of lower-limb malformations including mirror-image polydactyly. (PMID: 22258522) Klopocki E … Kurth I (European journal of human genetics : EJHG 2012) 3 4 58
  5. Homeotic arm-to-leg transformation associated with genomic rearrangements at the PITX1 locus. (PMID: 23022097) Spielmann M … Mundlos S (American journal of human genetics 2012) 3 4 58

Products for PITX1 Gene

Sources for PITX1 Gene

Content
Loading form....