This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzi... See more...

Aliases for PIGS Gene

Aliases for PIGS Gene

  • Phosphatidylinositol Glycan Anchor Biosynthesis Class S 2 3 5
  • Phosphatidylinositol-Glycan Biosynthesis Class S Protein 3 4
  • Phosphatidylinositol Glycan, Class S 2 3
  • GPI Transamidase Component PIG-S 3 4
  • GPI Transamidase Subunit 2 3
  • GPIBD18 3

External Ids for PIGS Gene

Previous GeneCards Identifiers for PIGS Gene

  • GC17M026725
  • GC17M028780
  • GC17M027025
  • GC17M023904
  • GC17M026880
  • GC17M023089

Summaries for PIGS Gene

Entrez Gene Summary for PIGS Gene

  • This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]

GeneCards Summary for PIGS Gene

PIGS (Phosphatidylinositol Glycan Anchor Biosynthesis Class S) is a Protein Coding gene. Diseases associated with PIGS include Glycosylphosphatidylinositol Biosynthesis Defect 18 and Taeniasis. Among its related pathways are Metabolism and Post-translational modification- synthesis of GPI-anchored proteins. Gene Ontology (GO) annotations related to this gene include GPI-anchor transamidase activity.

UniProtKB/Swiss-Prot Summary for PIGS Gene

  • Component of the GPI transamidase complex. Essential for transfer of GPI to proteins, particularly for formation of carbonyl intermediates.

Gene Wiki entry for PIGS Gene

Additional gene information for PIGS Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PIGS Gene

Genomics for PIGS Gene

GeneHancer (GH) Regulatory Elements for PIGS Gene

Promoters and enhancers for PIGS Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J028569 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE CraniofacialAtlas 750.6 +0.6 629 2.9 SIN3A SP1 ZBTB40 SMARCE1 POLR2A HCFC1 MYC NFYC ELF1 L3MBTL2 ENSG00000265168 PIGS lnc-ALDOC-1 PROCA1 LOC101927018 ENSG00000264577 NUFIP2 ENSG00000264044 ENSG00000265205 ENSG00000265908
GH17J028563 Promoter/Enhancer 1 EPDnew Ensembl ENCODE 750.4 +8.1 8101 1.1 ELF3 ELF1 SP1 TEAD1 NFIA TEAD3 lnc-UNC119-1 PIGS lnc-ALDOC-1 ENSG00000258472 RF00017-2319
GH17J028558 Promoter 0.4 EPDnew 750.4 +13.3 13283 0.1 ZSCAN29 PIGS UNC119 lnc-UNC119-1 ENSG00000258472 RF00017-2319
GH17J028560 Promoter 0.3 EPDnew 750.4 +11.7 11729 0.1 PIGS lnc-UNC119-1 UNC119 ENSG00000258472 RF00017-2319
GH17J028546 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE CraniofacialAtlas 22.2 +21.5 21459 7.7 CTCF ZBTB6 POLR2A ZNF362 ZNF701 ETV6 RELA L3MBTL2 RAD21 ZNF148 UNC119 PIGS ENSG00000264577 NUFIP2 LOC101927018 PHF12 ENSG00000265205 SDF2 FOXN1 SUPT6H
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PIGS on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PIGS gene promoter:
  • AP-1
  • c-Fos
  • c-Jun
  • GR
  • GR-alpha

Genomic Locations for PIGS Gene

Genomic Locations for PIGS Gene
chr17:28,553,383-28,571,869
(GRCh38/hg38)
Size:
18,487 bases
Orientation:
Minus strand
chr17:26,880,401-26,898,890
(GRCh37/hg19)
Size:
18,490 bases
Orientation:
Minus strand

Genomic View for PIGS Gene

Genes around PIGS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PIGS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PIGS Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PIGS Gene

Proteins for PIGS Gene

  • Protein details for PIGS Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96S52-PIGS_HUMAN
    Recommended name:
    GPI transamidase component PIG-S
    Protein Accession:
    Q96S52
    Secondary Accessions:
    • Q6UVX6

    Protein attributes for PIGS Gene

    Size:
    555 amino acids
    Molecular mass:
    61656 Da
    Quaternary structure:
    • Forms a complex with PIGK/GPI8, PIGT, PIGU and GAA1.

    Alternative splice isoforms for PIGS Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for PIGS Gene

Post-translational modifications for PIGS Gene

  • Glycosylation at Asn267 and Asn370
  • Modification sites at PhosphoSitePlus
  • Glycosylation from GlyConnect

Other Protein References for PIGS Gene

No data available for DME Specific Peptides for PIGS Gene

Domains & Families for PIGS Gene

Gene Families for PIGS Gene

HGNC:
Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted membrane proteins

Protein Domains for PIGS Gene

Suggested Antigen Peptide Sequences for PIGS Gene

GenScript: Design optimal peptide antigens:
  • Phosphatidylinositol-glycan biosynthesis class S protein (PIGS_HUMAN)
  • PIGS protein (Q96IR5_HUMAN)
  • PIGS protein (Q9BVC1_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96S52

UniProtKB/Swiss-Prot:

PIGS_HUMAN :
  • Belongs to the PIGS family.
Family:
  • Belongs to the PIGS family.
genes like me logo Genes that share domains with PIGS: view

Function for PIGS Gene

Molecular function for PIGS Gene

UniProtKB/Swiss-Prot Function:
Component of the GPI transamidase complex. Essential for transfer of GPI to proteins, particularly for formation of carbonyl intermediates.

Phenotypes From GWAS Catalog for PIGS Gene

Gene Ontology (GO) - Molecular Function for PIGS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003923 contributes_to GPI-anchor transamidase activity TAS 11483512
GO:0005515 protein binding IPI 11483512
genes like me logo Genes that share ontologies with PIGS: view
genes like me logo Genes that share phenotypes with PIGS: view

Human Phenotype Ontology for PIGS Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PIGS

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for PIGS Gene

Localization for PIGS Gene

Subcellular locations from UniProtKB/Swiss-Prot for PIGS Gene

Endoplasmic reticulum membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PIGS gene
Compartment Confidence
endoplasmic reticulum 5
plasma membrane 1

Gene Ontology (GO) - Cellular Components for PIGS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0016020 membrane HDA,IEA 19946888
GO:0016021 integral component of membrane IEA --
GO:0042765 GPI-anchor transamidase complex IEA,TAS 15713669
genes like me logo Genes that share ontologies with PIGS: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for PIGS Gene

Pathways & Interactions for PIGS Gene

genes like me logo Genes that share pathways with PIGS: view

UniProtKB/Swiss-Prot Q96S52-PIGS_HUMAN

  • Pathway: Glycolipid biosynthesis; glycosylphosphatidylinositol-anchor biosynthesis.

Gene Ontology (GO) - Biological Process for PIGS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006506 GPI anchor biosynthetic process IEA --
GO:0016255 attachment of GPI anchor to protein TAS,IEA 11483512
genes like me logo Genes that share ontologies with PIGS: view

No data available for SIGNOR curated interactions for PIGS Gene

Drugs & Compounds for PIGS Gene

(4) Drugs for PIGS Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Phytosphingosine Experimental Pharma 0
Sphingosine Experimental Pharma 0
sphinganine Pharma 0
Sphingosine-1-phosphate Pharma Full agonist, Agonist endogenous second messenger and ligand for S1PR1, Endogenous agonist at S1P1-5 0

(893) Additional Compounds for PIGS Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
3-Dehydrosphinganine
  • 3-dehydro-D-Sphinganine
  • 3-Ketodihydrosphingosine
  • 3-Ketosphinganine
  • (2S)-2-amino-1-Hydroxyoctadecan-3-one
  • 1-Hydroxy-2-amino-3-oxo-octadecane
16105-69-4
3-O-Sulfogalactosylceramide (d18:1/12:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-SulfO-beta-D-galactosylceramide
  • 3-O-SulfO-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
852100-88-0
3-O-Sulfogalactosylceramide (d18:1/14:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-SulfO-beta-D-galactosylceramide
  • 3-O-SulfO-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
3-O-Sulfogalactosylceramide (d18:1/16:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-SulfO-beta-D-galactosylceramide
  • 3-O-SulfO-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
862509-48-6
3-O-Sulfogalactosylceramide (d18:1/18:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-SulfO-beta-D-galactosylceramide
  • 3-O-SulfO-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
244215-65-4
genes like me logo Genes that share compounds with PIGS: view

Transcripts for PIGS Gene

mRNA/cDNA for PIGS Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PIGS

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PIGS Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b ^ 5a · 5b · 5c ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b ^ 9a · 9b ^ 10a · 10b ^ 11a · 11b ^ 12 ^ 13
SP1: - - - -
SP2: - - - -
SP3: - - - - - - - - - - - - -
SP4: - -
SP5: - - -
SP6: - - - -
SP7: -
SP8:
SP9: - -

Relevant External Links for PIGS Gene

GeneLoc Exon Structure for
PIGS
ECgene alternative splicing isoforms for
PIGS

Expression for PIGS Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PIGS Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for PIGS Gene

This gene is overexpressed in Bone (33.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PIGS Gene



Protein tissue co-expression partners for PIGS Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PIGS Gene:

PIGS

SOURCE GeneReport for Unigene cluster for PIGS Gene:

Hs.462550

Evidence on tissue expression from TISSUES for PIGS Gene

  • Lung(4.4)
  • Nervous system(4.2)
genes like me logo Genes that share expression patterns with PIGS: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PIGS Gene

Orthologs for PIGS Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PIGS Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PIGS 33 32
  • 99.52 (n)
OneToOne
cow
(Bos Taurus)
Mammalia PIGS 33 32
  • 89.67 (n)
OneToOne
dog
(Canis familiaris)
Mammalia PIGS 33 32
  • 89.19 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Pigs 32
  • 87.81 (n)
mouse
(Mus musculus)
Mammalia Pigs 17 33 32
  • 87.21 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia PIGS 33
  • 70 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia PIGS 33
  • 69 (a)
OneToOne
chicken
(Gallus gallus)
Aves PIGS 33 32
  • 66.87 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia PIGS 33
  • 62 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia pigs 32
  • 60.49 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.15898 32
zebrafish
(Danio rerio)
Actinopterygii pigs 33 32
  • 59.44 (n)
OneToOne
Dr.17191 32
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP002933 32
  • 47.11 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG31120 33 32
  • 44.59 (n)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea hpo-5 33
  • 20 (a)
OneToOne
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ADR180C 32
  • 42.86 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0B01045g 32
  • 40.88 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes GPI17 35 33 32
  • 40.4 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT3G07180 32
  • 40.56 (n)
rice
(Oryza sativa)
Liliopsida Os01g0907300 32
  • 41.25 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU06033 32
  • 44.15 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 42 (a)
OneToOne
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes gpi17 32
  • 40.77 (n)
Species where no ortholog for PIGS was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PIGS Gene

ENSEMBL:
Gene Tree for PIGS (if available)
TreeFam:
Gene Tree for PIGS (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PIGS: view image

Paralogs for PIGS Gene

(1) SIMAP similar genes for PIGS Gene using alignment to 6 proteins:

  • PIGS_HUMAN
  • F5H019_HUMAN
  • H0Y2N5_HUMAN
  • K7EN97_HUMAN
  • Q96IR5_HUMAN
  • Q9BVC1_HUMAN
genes like me logo Genes that share paralogs with PIGS: view

No data available for Paralogs for PIGS Gene

Variants for PIGS Gene

Sequence variations from dbSNP and Humsavar for PIGS Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1263517814 pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 28,571,115(-) C/T coding_sequence_variant, stop_gained
rs1426262136 pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18, Glycosylphosphatidylinositol biosynthesis defect 18 (GPIBD18) [MIM:618143] 28,558,487(-) T/C coding_sequence_variant, missense_variant
rs1567614073 pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 28,554,891(-) TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG/AGCAACC coding_sequence_variant, inframe_indel
rs1567616570 pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 28,563,430(-) C/G splice_donor_variant
rs1567618413 pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 28,571,122(-) A/G coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for PIGS Gene

Variant ID Type Subtype PubMed ID
nsv1064087 CNV gain 25217958
nsv1064958 CNV loss 25217958

Variation tolerance for PIGS Gene

Residual Variation Intolerance Score: 16.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.38; 63.51% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PIGS Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
PIGS

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PIGS Gene

Disorders for PIGS Gene

MalaCards: The human disease database

(2) MalaCards diseases for PIGS Gene - From: OMIM, ClinVar, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
glycosylphosphatidylinositol biosynthesis defect 18
  • gpibd18
taeniasis
  • beef tapeworm infection
- elite association - COSMIC cancer census association via MalaCards
Search PIGS in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

PIGS_HUMAN
  • Glycosylphosphatidylinositol biosynthesis defect 18 (GPIBD18) [MIM:618143]: An autosomal recessive disorder with onset in utero or early infancy and characterized by severe global developmental delay, seizures, hypotonia, weakness, ataxia, and dysmorphic facial features. {ECO:0000269 PubMed:30269814}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for PIGS

genes like me logo Genes that share disorders with PIGS: view

No data available for Genatlas for PIGS Gene

Publications for PIGS Gene

  1. Mutations in PIGS, Encoding a GPI Transamidase, Cause a Neurological Syndrome Ranging from Fetal Akinesia to Epileptic Encephalopathy. (PMID: 30269814) Nguyen TTM … Campeau PM (American journal of human genetics 2018) 3 4 56
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
  3. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PMID: 12975309) Clark HF … Gray A (Genome research 2003) 3 4 56
  4. PIG-S and PIG-T, essential for GPI anchor attachment to proteins, form a complex with GAA1 and GPI8. (PMID: 11483512) Ohishi K … Kinoshita T (The EMBO journal 2001) 3 4 56
  5. Quantitative mapping of RNA-mediated nuclear estrogen receptor β interactome in human breast cancer cells. (PMID: 29509190) Giurato G … Tarallo R (Scientific data 2018) 3 56

Products for PIGS Gene

Sources for PIGS Gene