Free for academic non-profit institutions. Other users need a Commercial license
This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzi... See more...
Aliases for PIGS Gene
Aliases for PIGS Gene
External Ids for PIGS Gene
- HGNC: 14937
- Entrez Gene: 94005
- Ensembl: ENSG00000087111
- OMIM: 610271
- UniProtKB: Q96S52
Previous GeneCards Identifiers for PIGS Gene
- GC17M026725
- GC17M028780
- GC17M027025
- GC17M023904
- GC17M026880
- GC17M023089
Summaries for PIGS Gene
-
This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
GeneCards Summary for PIGS Gene
PIGS (Phosphatidylinositol Glycan Anchor Biosynthesis Class S) is a Protein Coding gene. Diseases associated with PIGS include Glycosylphosphatidylinositol Biosynthesis Defect 18 and Taeniasis. Among its related pathways are Metabolism and Post-translational modification- synthesis of GPI-anchored proteins. Gene Ontology (GO) annotations related to this gene include GPI-anchor transamidase activity.
UniProtKB/Swiss-Prot Summary for PIGS Gene
-
Component of the GPI transamidase complex. Essential for transfer of GPI to proteins, particularly for formation of carbonyl intermediates.
No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PIGS Gene
Genomics for PIGS Gene
GeneHancer (GH) Regulatory Elements for PIGS Gene
Promoters and enhancers for PIGS Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around PIGS on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the PIGS gene promoter:
-
- AP-1
- c-Fos
- c-Jun
- GR
- GR-alpha
Genomic Locations for PIGS Gene
Genomic Locations for PIGS Gene
- chr17:28,553,383-28,571,869
- (GRCh38/hg38)
- Size:
- 18,487 bases
- Orientation:
- Minus strand
- chr17:26,880,401-26,898,890
- (GRCh37/hg19)
- Size:
- 18,490 bases
- Orientation:
- Minus strand
Genomic View for PIGS Gene
Genes around PIGS on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 17q11.2 by HGNC
- 17q11.2 by Entrez Gene
- 17q11.2 by Ensembl
PIGS Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for PIGS Gene
Proteins for PIGS Gene
-
Protein details for PIGS Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q96S52-PIGS_HUMAN
- Recommended name:
- GPI transamidase component PIG-S
- Protein Accession:
- Q96S52
- Q6UVX6
Protein attributes for PIGS Gene
- Size:
- 555 amino acids
- Molecular mass:
- 61656 Da
- Quaternary structure:
-
- Forms a complex with PIGK/GPI8, PIGT, PIGU and GAA1.
Protein Expression for PIGS Gene
Post-translational modifications for PIGS Gene
Other Protein References for PIGS Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Atlas Antibodies Anti-PIGS Antibody
-
Custom Antibody ServicesOriGene Antibodies for PIGS
- Novus Biologicals Antibodies for PIGS
-
Abcam antibodies for PIGS
- Invitrogen Antibodies for PIGS (AFLGC-PIGS)
-
Santa Cruz Biotechnology (SCBT) Antibodies for PIGS
Protein Products
- Atlas Antibodies PrEST Antigen PIGS
-
OriGene Purified Proteins for PIGS
- Search Origene for MassSpec and Protein Over-expression Lysates for PIGS
- Origene Custom Protein Services for PIGS
-
Abcam proteins for PIGS
No data available for DME Specific Peptides for PIGS Gene
Domains & Families for PIGS Gene
Gene Families for PIGS Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Plasma proteins
- Predicted membrane proteins
Protein Domains for PIGS Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for PIGS Gene
- GenScript: Design optimal peptide antigens:
-
- Phosphatidylinositol-glycan biosynthesis class S protein (PIGS_HUMAN)
- PIGS protein (Q96IR5_HUMAN)
- PIGS protein (Q9BVC1_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q96S52- Family:
-
- Belongs to the PIGS family.
Function for PIGS Gene
Molecular function for PIGS Gene
- UniProtKB/Swiss-Prot Function:
- Component of the GPI transamidase complex. Essential for transfer of GPI to proteins, particularly for formation of carbonyl intermediates.
Phenotypes From GWAS Catalog for PIGS Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003923 | contributes_to GPI-anchor transamidase activity | TAS | 11483512 |
| GO:0005515 | protein binding | IPI | 11483512 |
Phenotypes for PIGS Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for PIGS
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PIGS
- genomics-online: gRNA clones - Search results for available PIGS gene related products
- Applied Biological Materials (abm): CRISPR Clones for PIGS - Select products 50% OFF >
- * PIGS CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * PIGS CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for PIGS
miRNA for PIGS Gene
- miRTarBase miRNAs that target PIGS
-
- hsa-mir-1-3p (MIRT023832)
- hsa-mir-941 (MIRT036573)
- hsa-mir-877-3p (MIRT037030)
- hsa-mir-331-3p (MIRT043511)
- hsa-mir-92a-3p (MIRT049567)
- hsa-mir-17-5p (MIRT050805)
- hsa-let-7e-5p (MIRT051472)
- hsa-mir-3157-5p (MIRT052667)
- hsa-mir-516b-5p (MIRT145081)
- hsa-mir-6807-5p (MIRT454368)
- hsa-mir-1257 (MIRT454369)
- hsa-mir-6739-5p (MIRT454370)
- hsa-mir-6733-5p (MIRT454371)
- hsa-mir-3153 (MIRT454372)
- hsa-mir-4668-5p (MIRT454373)
- hsa-mir-4790-3p (MIRT454374)
- hsa-mir-125a-3p (MIRT454375)
- hsa-mir-1273d (MIRT454376)
- hsa-mir-1200 (MIRT609989)
- hsa-mir-767-5p (MIRT609990)
- hsa-mir-642b-3p (MIRT609991)
- hsa-mir-642a-3p (MIRT609992)
- hsa-mir-6719-3p (MIRT609993)
- hsa-mir-4526 (MIRT609994)
- hsa-mir-3660 (MIRT609995)
- hsa-mir-6730-3p (MIRT609996)
- hsa-mir-301b-5p (MIRT609997)
- hsa-mir-301a-5p (MIRT609998)
- hsa-mir-544b (MIRT609999)
- hsa-mir-4324 (MIRT610000)
- hsa-mir-3065-3p (MIRT610001)
- hsa-mir-29c-3p (MIRT610002)
- hsa-mir-29b-3p (MIRT610003)
- hsa-mir-29a-3p (MIRT610004)
- hsa-mir-8485 (MIRT610005)
- hsa-mir-5706 (MIRT644416)
- hsa-mir-4782-5p (MIRT644417)
- hsa-mir-1299 (MIRT644418)
- hsa-mir-6128 (MIRT644419)
- hsa-mir-875-3p (MIRT644420)
- hsa-mir-19b-3p (MIRT726943)
- hsa-mir-19a-3p (MIRT726944)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PIGS
- Browse OriGene Inhibitory RNA Products For PIGS
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PIGS
- genomics-online: shRNA clones - Search results for available PIGS gene related products
Clone Products
- Sino Biological Human cDNA Clone for PIGS
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PIGS
- genomics-online: cdna clones - Search results for available PIGS gene related products
- orf clones - Search results for available PIGS gene related products
- Applied Biological Materials (abm): Clones for PIGS - Select products 50% OFF >
- * PIGS as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * PIGS tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Cell Line Products
-
Horizon Cell Lines for PIGS
No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for PIGS Gene
Localization for PIGS Gene
Subcellular locations from UniProtKB/Swiss-Prot for PIGS Gene
- Endoplasmic reticulum membrane; Multi-pass membrane protein.
| Compartment | Confidence |
|---|---|
| endoplasmic reticulum | 5 |
| plasma membrane | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005783 | endoplasmic reticulum | IEA | -- |
| GO:0005789 | endoplasmic reticulum membrane | TAS | -- |
| GO:0016020 | membrane | HDA,IEA | 19946888 |
| GO:0016021 | integral component of membrane | IEA | -- |
| GO:0042765 | GPI-anchor transamidase complex | IEA,TAS | 15713669 |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for PIGS Gene
Pathways & Interactions for PIGS Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Post-translational modification- synthesis of GPI-anchored proteins | ||
| 2 | Metabolism of proteins | ||
| 3 | Glycosylphosphatidylinositol (GPI)-anchor biosynthesis | ||
| 4 | Metabolism | ||
Pathways by source for PIGS Gene
2 KEGG pathways for PIGS Gene
UniProtKB/Swiss-Prot Q96S52-PIGS_HUMAN
- Pathway: Glycolipid biosynthesis; glycosylphosphatidylinositol-anchor biosynthesis.
Interacting Proteins for PIGS Gene
Selected Interacting proteins:
Q96S52-PIGS_HUMAN
ENSP00000309430
for PIGS Gene via
UniProtKB
STRING
IID
GPS-Prot Interaction Network for PIGS
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006506 | GPI anchor biosynthetic process | IEA | -- |
| GO:0016255 | attachment of GPI anchor to protein | TAS,IEA | 11483512 |
No data available for SIGNOR curated interactions for PIGS Gene
Drugs & Compounds for PIGS Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| Phytosphingosine | Experimental | Pharma | 0 | |||
| Sphingosine | Experimental | Pharma | 0 | |||
| sphinganine | Pharma | 0 | ||||
| Sphingosine-1-phosphate | Pharma | Full agonist, Agonist | endogenous second messenger and ligand for S1PR1, Endogenous agonist at S1P1-5 | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs | |
|---|---|---|---|---|---|---|
| 3-Dehydrosphinganine |
|
16105-69-4 |
|
|||
| 3-O-Sulfogalactosylceramide (d18:1/12:0) |
|
852100-88-0 |
|
|||
| 3-O-Sulfogalactosylceramide (d18:1/14:0) |
|
|
||||
| 3-O-Sulfogalactosylceramide (d18:1/16:0) |
|
862509-48-6 |
|
|||
| 3-O-Sulfogalactosylceramide (d18:1/18:0) |
|
244215-65-4 |
|
Drug Products
- Atlas Antibodies PrEST Antigen PIGS
Transcripts for PIGS Gene
mRNA/cDNA for PIGS Gene
- (1) REFSEQ mRNAs :
- (15) Additional mRNA sequences :
- (236) Selected AceView cDNA sequences:
- (15) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000268758 2397 bps (ENST00000268758.13)
- ENST00000487231 3088 bps (ENST00000487231.5)
- ENST00000492429 2658 bps (ENST00000492429.2)
- ENST00000395346 2815 bps (ENST00000395346.6)
- ENST00000308360 2529 bps (ENST00000308360.7)
CRISPR Products
-
OriGene CRISPR knockouts for PIGS
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PIGS
- genomics-online: gRNA clones - Search results for available PIGS gene related products
- Applied Biological Materials (abm): CRISPR Clones for PIGS - Select products 50% OFF >
- * PIGS CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * PIGS CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for PIGS
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PIGS
- Browse OriGene Inhibitory RNA Products For PIGS
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PIGS
- genomics-online: shRNA clones - Search results for available PIGS gene related products
Clone Products
- Sino Biological Human cDNA Clone for PIGS
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PIGS
- genomics-online: cdna clones - Search results for available PIGS gene related products
- orf clones - Search results for available PIGS gene related products
- Applied Biological Materials (abm): Clones for PIGS - Select products 50% OFF >
- * PIGS as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * PIGS tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
| ExUns: | 1 | ^ | 2a | · | 2b | · | 2c | ^ | 3 | ^ | 4a | · | 4b | ^ | 5a | · | 5b | · | 5c | ^ | 6a | · | 6b | ^ | 7a | · | 7b | ^ | 8a | · | 8b | ^ | 9a | · | 9b | ^ | 10a | · | 10b | ^ | 11a | · | 11b | ^ | 12 | ^ | 13 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||
| SP2: | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||
| SP3: | - | - | - | - | - | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||
| SP4: | - | - | |||||||||||||||||||||||||||||||||||||||||||||
| SP5: | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||
| SP6: | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||
| SP7: | - | ||||||||||||||||||||||||||||||||||||||||||||||
| SP8: | |||||||||||||||||||||||||||||||||||||||||||||||
| SP9: | - | - |
Expression for PIGS Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Brain (Nervous System)
- Neural Tube (Nervous System)
- Kidney (Urinary System)
This gene is overexpressed in Bone (33.7).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PIGS Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of PIGS Gene:
PIGSSOURCE GeneReport for Unigene cluster for PIGS Gene:
Hs.462550Evidence on tissue expression from TISSUES for PIGS Gene
- Lung(4.4)
- Nervous system(4.2)
Primer Products
-
OriGene qPCR primer pairs for PIGS
- genomics-online: primer clones - Search results for available PIGS gene related products
Gene Expression Assay Products
No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PIGS Gene
Orthologs for PIGS Gene
This gene was present in the common ancestor of eukaryotes.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | PIGS 33 32 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | PIGS 33 32 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | PIGS 33 32 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Pigs 32 |
|
||
| mouse (Mus musculus) |
Mammalia | Pigs 17 33 32 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | PIGS 33 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | PIGS 33 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | PIGS 33 32 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | PIGS 33 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | pigs 32 |
|
||
| African clawed frog (Xenopus laevis) |
Amphibia | Xl.15898 32 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | pigs 33 32 |
|
OneToOne | |
| Dr.17191 32 |
|
||||
| African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP002933 32 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | CG31120 33 32 |
|
OneToOne | |
| worm (Caenorhabditis elegans) |
Secernentea | hpo-5 33 |
|
OneToOne | |
| A. gosspyii yeast (Ashbya gossypii) |
Saccharomycetes | AGOS_ADR180C 32 |
|
||
| K. lactis yeast (Kluyveromyces lactis) |
Saccharomycetes | KLLA0B01045g 32 |
|
||
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | GPI17 35 33 32 |
|
||
| thale cress (Arabidopsis thaliana) |
eudicotyledons | AT3G07180 32 |
|
||
| rice (Oryza sativa) |
Liliopsida | Os01g0907300 32 |
|
||
| bread mold (Neurospora crassa) |
Ascomycetes | NCU06033 32 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 33 |
|
OneToOne | |
| fission yeast (Schizosaccharomyces pombe) |
Schizosaccharomycetes | gpi17 32 |
|
- Species where no ortholog for PIGS was found in the sources mined by GeneCards:
-
- Actinobacteria (Mycobacterium tuberculosis)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for PIGS Gene
- ENSEMBL:
- Gene Tree for PIGS (if available)
- TreeFam:
- Gene Tree for PIGS (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for PIGS: view image
Paralogs for PIGS Gene
(1) SIMAP similar genes for PIGS Gene using alignment to 6 proteins:
- PIGS_HUMAN
- F5H019_HUMAN
- H0Y2N5_HUMAN
- K7EN97_HUMAN
- Q96IR5_HUMAN
- Q9BVC1_HUMAN
No data available for Paralogs for PIGS Gene
Variants for PIGS Gene
| SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1263517814 | pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 | 28,571,115(-) | C/T | coding_sequence_variant, stop_gained | |
| rs1426262136 | pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18, Glycosylphosphatidylinositol biosynthesis defect 18 (GPIBD18) [MIM:618143] | 28,558,487(-) | T/C | coding_sequence_variant, missense_variant | |
| rs1567614073 | pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 | 28,554,891(-) | TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG/AGCAACC | coding_sequence_variant, inframe_indel | |
| rs1567616570 | pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 | 28,563,430(-) | C/G | splice_donor_variant | |
| rs1567618413 | pathogenic, GLYCOSYLPHOSPHATIDYLINOSITOL BIOSYNTHESIS DEFECT 18 | 28,571,122(-) | A/G | coding_sequence_variant, missense_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv1064087 | CNV | gain | 25217958 |
| nsv1064958 | CNV | loss | 25217958 |
Residual Variation Intolerance Score:
16.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
4.38;
63.51% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for PIGS Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- PIGS
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PIGS Gene
Disorders for PIGS Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| glycosylphosphatidylinositol biosynthesis defect 18 |
|
|
| taeniasis |
|
|
Search PIGS in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
PIGS_HUMAN- Glycosylphosphatidylinositol biosynthesis defect 18 (GPIBD18) [MIM:618143]: An autosomal recessive disorder with onset in utero or early infancy and characterized by severe global developmental delay, seizures, hypotonia, weakness, ataxia, and dysmorphic facial features. {ECO:0000269 PubMed:30269814}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for PIGS
No data available for Genatlas for PIGS Gene
Publications for PIGS Gene
- Mutations in PIGS, Encoding a GPI Transamidase, Cause a Neurological Syndrome Ranging from Fetal Akinesia to Epileptic Encephalopathy. (PMID: 30269814) Nguyen TTM … Campeau PM (American journal of human genetics 2018) 3 4 56
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
- The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PMID: 12975309) Clark HF … Gray A (Genome research 2003) 3 4 56
- PIG-S and PIG-T, essential for GPI anchor attachment to proteins, form a complex with GAA1 and GPI8. (PMID: 11483512) Ohishi K … Kinoshita T (The EMBO journal 2001) 3 4 56
- Quantitative mapping of RNA-mediated nuclear estrogen receptor β interactome in human breast cancer cells. (PMID: 29509190) Giurato G … Tarallo R (Scientific data 2018) 3 56
ExternalLinks
Products for PIGS Gene
- Custom Antibody ServicesOriGene Antibodies for PIGS
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for PIGS
- Search Origene for MassSpec and Protein Over-expression Lysates for PIGS
- Origene Custom Protein Services for PIGS
- Origene sirna, shrna, and RNAi products in human, mouse, rat for PIGS
- Browse OriGene Inhibitory RNA Products For PIGS
- OriGene qPCR primer pairs for PIGS
- OriGene CRISPR knockouts for PIGS
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For PIGS
- Sino Biological Human cDNA Clone for PIGS
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for PIGS
- Novus Biologicals proteins and lysates for PIGS
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for PIGS
- Abcam proteins for PIGS
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for PIGS (AFLGC-PIGS)
- antibodies-online: Show 10 available PIGS Antibodies ranked by validation data
- Compare Top PIGS Antibodies
- antibodies-online: Search results for available PIGS related products ranked by validation data
- antibodies-online: Show 6 available PIGS Proteins ranked by validation data
- Compare Top PIGS Proteins
- Santa Cruz Biotechnology (SCBT) Antibodies for PIGS
- Search Santa Cruz Biotechnology (SCBT) for PIGS siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for PIGS
- Horizon Cell Lines for PIGS
- genomics-online: cdna clones - Search results for available PIGS gene related products
- orf clones - Search results for available PIGS gene related products
- genomics-online: gRNA clones - Search results for available PIGS gene related products
- genomics-online: primer clones - Search results for available PIGS gene related products
- genomics-online: shRNA clones - Search results for available PIGS gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for PIGS
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for PIGS
- Search GeneCopoeia for miRNA 3'UTR Target clone products for PIGS
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PIGS
Sources for PIGS Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource