Aliases for PHLDB3 Gene

Aliases for PHLDB3 Gene

  • Pleckstrin Homology Like Domain Family B Member 3 2 3 5
  • Pleckstrin Homology-Like Domain Family B Member 3 3 4
  • Pleckstrin Homology-Like Domain, Family B, Member 3 2

External Ids for PHLDB3 Gene

Previous GeneCards Identifiers for PHLDB3 Gene

  • GC19M048694
  • GC19M048677
  • GC19M043983
  • GC19M040410

Summaries for PHLDB3 Gene

GeneCards Summary for PHLDB3 Gene

PHLDB3 (Pleckstrin Homology Like Domain Family B Member 3) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include enzyme binding. An important paralog of this gene is PHLDB1.

Additional gene information for PHLDB3 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PHLDB3 Gene

Genomics for PHLDB3 Gene

GeneHancer (GH) Regulatory Elements for PHLDB3 Gene

Promoters and enhancers for PHLDB3 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PHLDB3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PHLDB3 gene promoter:
  • E47
  • GCNF
  • GCNF-1
  • GCNF-2
  • ITF-2
  • Pax-3
  • Sp1
  • Tal-1
  • Tal-1beta

Genomic Locations for PHLDB3 Gene

Genomic Locations for PHLDB3 Gene
chr19:43,474,341-43,504,935
(GRCh38/hg38)
Size:
30,595 bases
Orientation:
Minus strand
chr19:43,979,106-44,009,087
(GRCh37/hg19)
Size:
29,982 bases
Orientation:
Minus strand

Genomic View for PHLDB3 Gene

Genes around PHLDB3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PHLDB3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PHLDB3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PHLDB3 Gene

Proteins for PHLDB3 Gene

  • Protein details for PHLDB3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6NSJ2-PHLB3_HUMAN
    Recommended name:
    Pleckstrin homology-like domain family B member 3
    Protein Accession:
    Q6NSJ2
    Secondary Accessions:
    • Q8N7Z4

    Protein attributes for PHLDB3 Gene

    Size:
    640 amino acids
    Molecular mass:
    71912 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAC05082.1; Type=Erroneous termination; Positions=169; Note=Translated as Glu.; Evidence={ECO:0000305};

    Alternative splice isoforms for PHLDB3 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for PHLDB3 Gene

Post-translational modifications for PHLDB3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for PHLDB3 Gene

Domains & Families for PHLDB3 Gene

Gene Families for PHLDB3 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for PHLDB3 Gene

Suggested Antigen Peptide Sequences for PHLDB3 Gene

GenScript: Design optimal peptide antigens:
  • PHLDB3 protein (B2RXH3_HUMAN)
  • Pleckstrin homology-like domain family B member 3 (PHLB3_HUMAN)
  • PHLDB3 protein (Q96HZ0_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q6NSJ2

UniProtKB/Swiss-Prot:

PHLB3_HUMAN :
  • The PH domain mediates the binding to phosphoinositides.
Domain:
  • The PH domain mediates the binding to phosphoinositides.
genes like me logo Genes that share domains with PHLDB3: view

Function for PHLDB3 Gene

Phenotypes From GWAS Catalog for PHLDB3 Gene

Gene Ontology (GO) - Molecular Function for PHLDB3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0019899 enzyme binding IPI 23382074
genes like me logo Genes that share ontologies with PHLDB3: view
genes like me logo Genes that share phenotypes with PHLDB3: view

miRNA for PHLDB3 Gene

miRTarBase miRNAs that target PHLDB3

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PHLDB3 Gene

Localization for PHLDB3 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PHLDB3 gene
Compartment Confidence
nucleus 3
cytosol 3
plasma membrane 1
extracellular 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nuclear speckles (2)
  • Plasma membrane (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for PHLDB3 Gene

Pathways & Interactions for PHLDB3 Gene

PathCards logo

SuperPathways for PHLDB3 Gene

No Data Available

Gene Ontology (GO) - Biological Process for PHLDB3 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for PHLDB3 Gene

Drugs & Compounds for PHLDB3 Gene

No Compound Related Data Available

Transcripts for PHLDB3 Gene

mRNA/cDNA for PHLDB3 Gene

(1) REFSEQ mRNAs :
(11) Additional mRNA sequences :
(9) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PHLDB3 Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b · 4c ^ 5a · 5b · 5c ^ 6a · 6b ^ 7a · 7b ^ 8 ^ 9
SP1: -
SP2: - -
SP3: - -
SP4: -
SP5:
SP6:

Relevant External Links for PHLDB3 Gene

GeneLoc Exon Structure for
PHLDB3
ECgene alternative splicing isoforms for
PHLDB3

Expression for PHLDB3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PHLDB3 Gene

mRNA differential expression in normal tissues according to GTEx for PHLDB3 Gene

This gene is overexpressed in Esophagus - Mucosa (x4.7), Skin - Sun Exposed (Lower leg) (x4.4), and Skin - Not Sun Exposed (Suprapubic) (x4.1).

Protein differential expression in normal tissues from HIPED for PHLDB3 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (31.0), Testis (22.6), and Liver (6.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for PHLDB3 Gene



Protein tissue co-expression partners for PHLDB3 Gene

NURSA nuclear receptor signaling pathways regulating expression of PHLDB3 Gene:

PHLDB3

SOURCE GeneReport for Unigene cluster for PHLDB3 Gene:

Hs.631581
genes like me logo Genes that share expression patterns with PHLDB3: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for PHLDB3 Gene

Orthologs for PHLDB3 Gene

This gene was present in the common ancestor of animals.

Orthologs for PHLDB3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PHLDB3 33
  • 96 (a)
OneToOne
cow
(Bos Taurus)
Mammalia PHLDB3 33 32
  • 84.92 (n)
OneToOne
dog
(Canis familiaris)
Mammalia PHLDB3 33 32
  • 84.72 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia PHLDB3 33
  • 84 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Phldb3 17 33 32
  • 80.97 (n)
rat
(Rattus norvegicus)
Mammalia Phldb3 32
  • 80.1 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 2 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia PHLDB3 33
  • 40 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia phldb3 32
  • 55.53 (n)
zebrafish
(Danio rerio)
Actinopterygii PHLDB3 33
  • 47 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG5004 33
  • 10 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5769 33
  • 24 (a)
OneToMany
Species where no ortholog for PHLDB3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PHLDB3 Gene

ENSEMBL:
Gene Tree for PHLDB3 (if available)
TreeFam:
Gene Tree for PHLDB3 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PHLDB3: view image

Paralogs for PHLDB3 Gene

Paralogs for PHLDB3 Gene

(5) SIMAP similar genes for PHLDB3 Gene using alignment to 7 proteins:

  • PHLB3_HUMAN
  • B2RXH3_HUMAN
  • M0QXT7_HUMAN
  • M0R038_HUMAN
  • M0R353_HUMAN
  • M0R3I7_HUMAN
  • Q96HZ0_HUMAN
genes like me logo Genes that share paralogs with PHLDB3: view

Variants for PHLDB3 Gene

Sequence variations from dbSNP and Humsavar for PHLDB3 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs201842186 uncertain-significance, Ethylmalonic encephalopathy 43,506,795(-) C/A/T upstream_transcript_variant
rs778362220 uncertain-significance, Ethylmalonic encephalopathy 43,506,819(-) T/C/G upstream_transcript_variant
rs1472698495 likely-pathogenic, not provided 43,506,873(-) C/T upstream_transcript_variant
rs1000099097 -- 43,484,848(-) CAATGCCCTAGAATTATTCTTATAATTCTAGCA/CA genic_downstream_transcript_variant, intron_variant
rs1000158147 -- 43,504,193(-) C/T 5_prime_UTR_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PHLDB3 Gene

Variant ID Type Subtype PubMed ID
dgv3603n100 CNV gain 25217958
esv2668877 CNV deletion 23128226
esv2762041 CNV loss 21179565
esv3644470 CNV loss 21293372
nsv1057657 CNV gain 25217958
nsv2502 CNV insertion 18451855
nsv509744 CNV insertion 20534489

Variation tolerance for PHLDB3 Gene

Residual Variation Intolerance Score: 92.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.21; 76.07% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PHLDB3 Gene

Human Gene Mutation Database (HGMD)
PHLDB3
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PHLDB3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PHLDB3 Gene

Disorders for PHLDB3 Gene

Additional Disease Information for PHLDB3

No disorders were found for PHLDB3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for PHLDB3 Gene

Publications for PHLDB3 Gene

  1. The DNA sequence and biology of human chromosome 19. (PMID: 15057824) Grimwood J … Lucas SM (Nature 2004) 3 4 56
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
  4. Proteomic profiling of VCP substrates links VCP to K6-linked ubiquitylation and c-Myc function. (PMID: 29467282) Heidelberger JB … Beli P (EMBO reports 2018) 3 56
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56

Products for PHLDB3 Gene

Sources for PHLDB3 Gene