Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PFKL Gene

Aliases for PFKL Gene

  • Phosphofructokinase, Liver Type 2 3 5
  • Phosphofructo-1-Kinase Isozyme B 3 4
  • 6-Phosphofructokinase Type B 3 4
  • Phosphohexokinase 3 4
  • ATP-PFK 3 4
  • PFK-B 3 4
  • PFK-L 3 4
  • ATP-Dependent 6-Phosphofructokinase, Liver Type 3
  • 6-Phosphofructokinase, Liver Type 3
  • Liver-Type 1-Phosphofructokinase 3
  • EC 4

External Ids for PFKL Gene

Previous GeneCards Identifiers for PFKL Gene

  • GC21P042229
  • GC21P044576
  • GC21P044544
  • GC21P045719
  • GC21P031062

Summaries for PFKL Gene

Entrez Gene Summary for PFKL Gene

  • This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

GeneCards Summary for PFKL Gene

PFKL (Phosphofructokinase, Liver Type) is a Protein Coding gene. Diseases associated with PFKL include Glycogen Storage Disease Vii. Among its related pathways are Akt Signaling and Central carbon metabolism in cancer. Gene Ontology (GO) annotations related to this gene include identical protein binding and monosaccharide binding. An important paralog of this gene is PFKM.

UniProtKB/Swiss-Prot for PFKL Gene

  • Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis (PubMed:22923583). Negatively regulates the phagocyte oxidative burst in response to bacterial infection by controlling cellular NADPH biosynthesis and NADPH oxidase-derived reactive oxygen species. Upon macrophage activation, drives the metabolic switch toward glycolysis, thus preventing glucose turnover that produces NADPH via pentose phosphate pathway (By similarity).

Gene Wiki entry for PFKL Gene

Additional gene information for PFKL Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PFKL Gene

Genomics for PFKL Gene

GeneHancer (GH) Regulatory Elements for PFKL Gene

Promoters and enhancers for PFKL Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH21J044297 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 673.2 +1.5 1451 8.5 HDGF CLOCK FOXA2 SMAD1 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 PFKL ENSG00000184441 RRP1B POFUT2 PWP2 UBE2G2 C21orf2 GC21P044298 GC21P044301 PIR46789
GH21J044024 Enhancer 1.4 Ensembl ENCODE dbSUPER 10.1 -274.2 -274235 2.7 HDGF SMAD1 ATF1 ARNT TCF12 ZNF766 ZFP91 ATF7 NCOA1 ZNF592 PWP2 U2AF1 RRP1B TRAPPC10 UBE2G2 ENSG00000184441 PFKL H2AFZP1
GH21J044152 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 8 -142.9 -142851 8.7 HDGF PKNOX1 SMAD1 IRF4 GLIS2 ZNF207 ZNF143 ATF7 RUNX3 JUNB PWP2 ICOSLG ENSG00000184441 C21orf2 PFKL LINC01678 TRPM2 TRAPPC10 CSTB PDXK
GH21J044169 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 7.9 -126.3 -126281 7.7 HDGF PKNOX1 FOXA2 SMAD1 MLX ARID4B DMAP1 IRF4 YY1 SLC30A9 ENSG00000237604 PWP2 ENSG00000184441 RRP1B SIK1 PFKL ICOSLG TRPM2 TRAPPC10 PDXK
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PFKL on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PFKL gene promoter:
  • AP-1
  • ATF-2

Genomic Locations for PFKL Gene

Genomic Locations for PFKL Gene
27,348 bases
Plus strand
27,337 bases
Plus strand

Genomic View for PFKL Gene

Genes around PFKL on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PFKL Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PFKL Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PFKL Gene

Proteins for PFKL Gene

  • Protein details for PFKL Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    ATP-dependent 6-phosphofructokinase, liver type
    Protein Accession:
    Secondary Accessions:
    • Q96A64
    • Q96IH4
    • Q9BR91

    Protein attributes for PFKL Gene

    780 amino acids
    Molecular mass:
    85018 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Homo- and heterotetramers (By similarity). Phosphofructokinase (PFK) enzyme functions as a tetramer composed of different combinations of 3 types of subunits, called PFKM (where M stands for Muscle), PFKL (Liver) and PFKP (Platelet). The composition of the PFK tetramer differs according to the tissue type it is present in. In muscles, it is composed of 4 PFKM subunits (also called M4). In the liver, the predominant form is a tetramer of PFKL subunits (L4). In erythrocytes, both PFKM and PFKL subunits randomly tetramerize to form M4, L4 and other combinations (ML3, M2L2, M3L). The kinetic and regulatory properties of the tetrameric enzyme are dependent on the subunit composition, hence can vary across tissues (Probable).
    • In human PFK exists as a system of 3 types of subunits, PFKM (muscle), PFKL (liver) and PFKP (platelet) isoenzymes.
    • Glycosylation may play a role in cancer cell proliferation: inhibition of 6-phosphofructokinase activity and subsequent redirection of the glucose flux through the oxidative pentose phosphate pathway confers a selective growth advantage on cancer cells. Moreover GlcNAcylation is observed in multiple cancer cell lines and tissue samples and GlcNAcylation leads to larger xenografts tunors in mice (PubMed:22923583).

    Alternative splice isoforms for PFKL Gene


neXtProt entry for PFKL Gene

Post-translational modifications for PFKL Gene

  • GlcNAcylation at Ser-529 by OGT decreases enzyme activity, leading to redirect glucose flux through the oxidative pentose phosphate pathway. Glycosylation is stimulated by both hypoxia and glucose deprivation.
  • Glycosylation at Ser529
  • Ubiquitination at Lys16
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for PFKL Gene

Domains & Families for PFKL Gene

Gene Families for PFKL Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for PFKL Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the phosphofructokinase type A (PFKA) family. ATP-dependent PFK group I subfamily. Eukaryotic two domain clade "E" sub-subfamily.
  • Belongs to the phosphofructokinase type A (PFKA) family. ATP-dependent PFK group I subfamily. Eukaryotic two domain clade "E" sub-subfamily.
genes like me logo Genes that share domains with PFKL: view

Function for PFKL Gene

Molecular function for PFKL Gene

UniProtKB/Swiss-Prot Function:
Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis (PubMed:22923583). Negatively regulates the phagocyte oxidative burst in response to bacterial infection by controlling cellular NADPH biosynthesis and NADPH oxidase-derived reactive oxygen species. Upon macrophage activation, drives the metabolic switch toward glycolysis, thus preventing glucose turnover that produces NADPH via pentose phosphate pathway (By similarity).
UniProtKB/Swiss-Prot CatalyticActivity:
ATP + D-fructose 6-phosphate = ADP + D-fructose 1,6-bisphosphate.
UniProtKB/Swiss-Prot EnzymeRegulation:
Allosterically activated by ADP, AMP, or fructose 2,6-bisphosphate, and allosterically inhibited by ATP or citrate. GlcNAcylation by OGT overcomes allosteric regulation.
GENATLAS Biochemistry:
6-phosphofructo-1-kinase,expressed in liver,fructose metabolism,energy patway

Enzyme Numbers (IUBMB) for PFKL Gene

Gene Ontology (GO) - Molecular Function for PFKL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003824 catalytic activity IEA --
GO:0003872 contributes_to 6-phosphofructokinase activity EXP,IMP 6227635
GO:0005515 protein binding IPI 6444721
GO:0005524 ATP binding IDA 8780720
GO:0016301 kinase activity IEA --
genes like me logo Genes that share ontologies with PFKL: view
genes like me logo Genes that share phenotypes with PFKL: view

Animal Model Products

  • Taconic Biosciences Mouse Models for PFKL

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PFKL

Clone Products

  • Addgene plasmids for PFKL

No data available for Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PFKL Gene

Localization for PFKL Gene

Subcellular locations from UniProtKB/Swiss-Prot for PFKL Gene


Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PFKL gene
Compartment Confidence
extracellular 5
cytosol 5
mitochondrion 3
nucleus 3
cytoskeleton 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Mitochondria (2)
  • Nucleoli (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PFKL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol TAS,IEA --
GO:0005945 6-phosphofructokinase complex IDA 6444532
GO:0016020 membrane HDA 19946888
genes like me logo Genes that share ontologies with PFKL: view

Pathways & Interactions for PFKL Gene

genes like me logo Genes that share pathways with PFKL: view

UniProtKB/Swiss-Prot P17858-PFKAL_HUMAN

  • Pathway: Carbohydrate degradation; glycolysis; D-glyceraldehyde 3-phosphate and glycerone phosphate from D-glucose: step 3/4.

Gene Ontology (GO) - Biological Process for PFKL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005975 carbohydrate metabolic process IEA --
GO:0006002 fructose 6-phosphate metabolic process IMP 6227635
GO:0006096 glycolytic process IDA 6227635
GO:0008152 metabolic process IEA --
GO:0009749 response to glucose IDA 22923583
genes like me logo Genes that share ontologies with PFKL: view

No data available for SIGNOR curated interactions for PFKL Gene

Drugs & Compounds for PFKL Gene

(11) Drugs for PFKL Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Magnesium Approved Nutra 0
CDP Experimental Pharma 0
Cytidine triphosphate Experimental Pharma 0
Fosfructose Experimental Pharma 0
Guanosine diphosphate Experimental Pharma 0

(9) Additional Compounds for PFKL Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 5'-Adenylphosphoric acid
  • Adenosine 5'-diphosphate
  • ADENOSINE-5'-diphosphATE
  • H3ADP
  • 5'-Adenylphosphate
Full agonist, Agonist, Partial agonist, Antagonist, Gating inhibitor 58-64-0
beta-D-Fructose 1,6-bisphosphate
  • 1,6-Di-O-phosphono-alpha-D-fructofuranose
  • ALPHA FRUCTOSE 1,6-diphosphATE
  • 1,6-Di-O-phosphono-a-D-fructofuranose
  • 1,6-Di-O-phosphono-α-D-fructofuranose
  • Fructose 1,6-bisphosphoric acid
Beta-D-Fructose 6-phosphate
  • 6-O-phosphono-beta-D-Fructofuranose
  • FRUCTOSE-6-phosphATE
  • 6-O-phosphono-b-D-Fructofuranose
  • 6-O-phosphono-β-D-fructofuranose
  • b-D-Fructose 6-phosphate
D-Tagatose 1,6-bisphosphate
  • 1,6-Di-O-phosphono-D-tagatofuranose
  • D-Tagatose 1,6-bisphosphoric acid
  • D-Tagatofuranose 1,6-bisphosphate
D-Tagatose 6-phosphate
  • 6-O-phosphono-D-Tagatofuranose
  • D-Tagatofuranose 6-(dihydrogen phosphate)
genes like me logo Genes that share compounds with PFKL: view

Transcripts for PFKL Gene

Unigene Clusters for PFKL Gene

Phosphofructokinase, liver:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PFKL

Clone Products

  • Addgene plasmids for PFKL

Alternative Splicing Database (ASD) splice patterns (SP) for PFKL Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11 ^ 12 ^ 13a · 13b ^ 14a · 14b ^ 15a · 15b ^ 16 ^ 17a · 17b ^ 18a ·
SP1: - - -
SP2: - - - - - -
SP3: - - - - - -
SP4: - - - - -
SP8: - - - - - - -
SP9: - - - -
SP10: - - - - - - -
SP11: - - - -
SP12: -
SP13: - - - - - - - - - - - - - - - -
SP16: - -
SP18: - -

ExUns: 18b · 18c ^ 19a · 19b · 19c · 19d ^ 20 ^ 21 ^ 22a · 22b · 22c ^ 23a · 23b ^ 24 ^ 25a · 25b · 25c · 25d ^ 26a · 26b · 26c ^ 27 ^ 28a · 28b · 28c · 28d
SP1: - - - - - -
SP2: - - - - - -
SP3: - - - - - -
SP4: - - - -
SP5: - - - - -
SP6: - - - -
SP7: - -
SP12: - - - - - - -
SP13: - -
SP14: -
SP15: - - - - - - - -
SP17: - -

Relevant External Links for PFKL Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PFKL Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PFKL Gene

Protein differential expression in normal tissues from HIPED for PFKL Gene

This gene is overexpressed in Retina (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for PFKL Gene

Protein tissue co-expression partners for PFKL Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PFKL Gene:


SOURCE GeneReport for Unigene cluster for PFKL Gene:


Evidence on tissue expression from TISSUES for PFKL Gene

  • Lung(4.7)
  • Liver(4.6)
  • Blood(4.5)
  • Muscle(4.5)
  • Nervous system(4.5)
  • Kidney(4.4)
  • Skin(3.7)
  • Eye(2.9)
  • Heart(2)
genes like me logo Genes that share expression patterns with PFKL: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PFKL Gene

Orthologs for PFKL Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for PFKL Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PFKL 34 33
  • 98.76 (n)
(Ornithorhynchus anatinus)
Mammalia PFKL 34
  • 90 (a)
(Canis familiaris)
Mammalia PFKL 34 33
  • 89.74 (n)
(Bos Taurus)
Mammalia PFKL 34 33
  • 89.1 (n)
(Monodelphis domestica)
Mammalia PFKL 34
  • 89 (a)
(Rattus norvegicus)
Mammalia Pfkl 33
  • 88.59 (n)
(Mus musculus)
Mammalia Pfkl 16 34 33
  • 87.22 (n)
(Gallus gallus)
Aves PFKL 34 33
  • 82.61 (n)
(Anolis carolinensis)
Reptilia PFKL 34
  • 87 (a)
(Danio rerio)
Actinopterygii PFKL (2 of 2) 34
  • 78 (a)
LOC570106 33
  • 73.5 (n)
pfklb 34
  • 73 (a)
-- 33
fruit fly
(Drosophila melanogaster)
Insecta Pfk 34 35
  • 46 (a)
(Caenorhabditis elegans)
Secernentea Y71H10A.1b 35
  • 56 (a)
Y71H10A.1a 35
  • 56 (a)
pfk-1 34
  • 53 (a)
pfk-2 34
  • 41 (a)
C50F4.2 35
  • 39 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AFL185W 33
  • 52.71 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0F06248g 33
  • 50.22 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes PFK2 34 33
  • 49.52 (n)
PFK1 36 34
  • 34 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU00629 33
  • 54.93 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes pfk1 33
  • 52.29 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 52 (a)
Species where no ortholog for PFKL was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for PFKL Gene

Gene Tree for PFKL (if available)
Gene Tree for PFKL (if available)
Evolutionary constrained regions (ECRs) for PFKL: view image

Paralogs for PFKL Gene

Paralogs for PFKL Gene

(6) SIMAP similar genes for PFKL Gene using alignment to 4 proteins:

  • Q7L2M7_HUMAN
genes like me logo Genes that share paralogs with PFKL: view

Variants for PFKL Gene

Sequence variations from dbSNP and Humsavar for PFKL Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1057034 benign, not specified 44,312,233(+) C/T coding_sequence_variant, genic_upstream_transcript_variant, synonymous_variant
rs1057037 benign, not specified 44,313,984(+) A/T coding_sequence_variant, genic_upstream_transcript_variant, missense_variant, upstream_transcript_variant
rs61750224 benign, not specified 44,314,028(+) G/A genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000081008 -- 44,298,947(+) T/A upstream_transcript_variant
rs1000209015 -- 44,319,104(+) CTGGAGCTGGAGCTG/CTGGAGCTGGAGCTGGAGCTG intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PFKL Gene

Variant ID Type Subtype PubMed ID
dgv7886n54 CNV loss 21841781
esv1005792 CNV gain 20482838
esv2347291 CNV deletion 18987734
esv24065 CNV loss 19812545
esv2723638 CNV deletion 23290073
esv2723640 CNV deletion 23290073
esv2723641 CNV deletion 23290073
esv3353185 CNV insertion 20981092
esv33817 CNV loss 17666407
esv3647130 CNV gain 21293372
nsv1058359 CNV gain 25217958
nsv509800 CNV insertion 20534489
nsv511633 CNV gain 21212237
nsv518709 CNV loss 19592680
nsv526673 CNV loss 19592680
nsv587740 CNV loss 21841781
nsv587774 CNV loss 21841781
nsv587775 CNV loss 21841781
nsv587778 CNV gain 21841781
nsv587779 CNV loss 21841781
nsv587780 CNV loss 21841781
nsv953646 CNV deletion 24416366

Variation tolerance for PFKL Gene

Residual Variation Intolerance Score: 19.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.64; 72.71% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PFKL Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PFKL Gene

Disorders for PFKL Gene

MalaCards: The human disease database

(1) MalaCards diseases for PFKL Gene - From: DISEASES

Disorder Aliases PubMed IDs
glycogen storage disease vii
  • gsd7
- elite association - COSMIC cancer census association via MalaCards
Search PFKL in MalaCards View complete list of genes associated with diseases

Genatlas disease for PFKL Gene

hemolytic anemia

Additional Disease Information for PFKL

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PFKL: view

No data available for UniProtKB/Swiss-Prot for PFKL Gene

Publications for PFKL Gene

  1. Phosphofructokinase 1 glycosylation regulates cell growth and metabolism. (PMID: 22923583) Yi W … Hsieh-Wilson LC (Science (New York, N.Y.) 2012) 3 4 58
  2. The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population. (PMID: 21505073) Terao C … Matsuda F (Human molecular genetics 2011) 3 44 58
  3. Physiogenomic analysis of statin-treated patients: domain-specific counter effects within the ACACB gene on low-density lipoprotein cholesterol? (PMID: 20602615) Ruaño G … Wu AH (Pharmacogenomics 2010) 3 44 58
  4. Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone. (PMID: 18996102) Ruaño G … Hanks S (Clinica chimica acta; international journal of clinical chemistry 2009) 3 44 58
  5. Physiogenomic comparison of human fat loss in response to diets restrictive of carbohydrate or fat. (PMID: 18254975) Seip RL … Ruaño G (Nutrition & metabolism 2008) 3 22 58

Products for PFKL Gene

Sources for PFKL Gene

Loading form....