This gene belongs to the paralemmin downstream gene (PDG) family defined in PMID:22855693. Paralemmin downstream genes may have evolved contiguously with the paralemmin genes and are associated with other paralemmin paralogs in humans and several other taxa. The gene encodes three distinct protein isoforms, the PALM2 isoform, the AKAP2 isoform and the PALM2-AKAP2 isoform. The b... See more...

Aliases for PALM2AKAP2 Gene

Aliases for PALM2AKAP2 Gene

  • PALM2 And AKAP2 Fusion 2 3
  • PALM2-AKAP2 Readthrough 2 3
  • PALM2-AKAP2 Fusion 2 3
  • Paralemmin 2 3 5
  • PALM2 3 5
  • Protein Kinase A Anchoring Protein 2 3
  • A Kinase (PRKA) Anchor Protein 2 3
  • A-Kinase Anchoring Protein 2 3
  • A-Kinase Anchor Protein 2 3
  • PALM2-AKAP2 Protein 3
  • Protein Kinase A2 3
  • Paralemmin-2 3
  • PALM2-AKAP2 3
  • AKAP-KL 3
  • AKAP-2 3
  • AKAPKL 3
  • AKAP2 3
  • MISP2 3
  • PRKA2 3

External Ids for PALM2AKAP2 Gene

Previous HGNC Symbols for PALM2AKAP2 Gene

  • PALM2-AKAP2

Summaries for PALM2AKAP2 Gene

Entrez Gene Summary for PALM2AKAP2 Gene

  • This gene belongs to the paralemmin downstream gene (PDG) family defined in PMID:22855693. Paralemmin downstream genes may have evolved contiguously with the paralemmin genes and are associated with other paralemmin paralogs in humans and several other taxa. The gene encodes three distinct protein isoforms, the PALM2 isoform, the AKAP2 isoform and the PALM2-AKAP2 isoform. The biological significance of the PALM2-AKAP2 isoforms is yet unknown. Earlier, PALM2 and AKAP2 were annotated as separate genes and PALM2-AKAP2 was annotated as a readthrough gene. [provided by RefSeq, May 2019]

GeneCards Summary for PALM2AKAP2 Gene

PALM2AKAP2 (PALM2 And AKAP2 Fusion) is a Protein Coding gene. Diseases associated with PALM2AKAP2 include Kallmann Syndrome. An important paralog of this gene is ENSG00000157654.

Additional gene information for PALM2AKAP2 Gene

No data available for CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PALM2AKAP2 Gene

Genomics for PALM2AKAP2 Gene

GeneHancer (GH) Regulatory Elements for PALM2AKAP2 Gene

Promoters and enhancers for PALM2AKAP2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J109640 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 750.6 -0.1 -96 1.8 CEBPG GLIS2 RFX1 ZBTB8A CTBP1 POLR2A CTCF EZH2 BMI1 ZBTB17 PALM2 PALM2AKAP2 RF01061-185 lnc-PALM2-1
GH09J110026 Enhancer 1.6 FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 8.9 +389.3 389312 9 LCORL RBPJ USF2 NR2F6 ATF1 CREB1 MYC HLF RAD21 MAX ENSG00000157654 PALM2 PALM2AKAP2 AKAP2 RF00017-7809 RPL21P87
GH09J109906 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 9.7 +274.0 274013 19.2 ZNF24 CTCF LCORL NR2F6 CREB1 ETV6 RAD21 SP1 ELF1 ZNF687 hsa-miR-5095-516 AKAP2 ENSG00000157654 PALM2 PALM2AKAP2 HE856165
GH09J109745 Enhancer 1.1 Ensembl ENCODE CraniofacialAtlas 11.2 +105.1 105113 2.2 SP1 PKNOX1 ZIC2 ZBTB8A ZEB2 ZNF629 POLR2A ZNF561 ZBTB20 ZXDB PALM2 LOC107987013 ENSG00000157654 PALM2AKAP2 AKAP2 RF00017-7807
GH09J109867 Promoter/Enhancer 1.2 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 10 +227.2 227163 1.6 PALM2 ENSG00000157654 AKAP2 PALM2AKAP2 piR-39341-436 hsa-miR-5095-516
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PALM2AKAP2 on UCSC Golden Path with GeneCards custom track

Genomic Locations for PALM2AKAP2 Gene

Genomic Locations for PALM2AKAP2 Gene
chr9:109,640,788-110,172,512
(GRCh38/hg38)
Size:
531,725 bases
Orientation:
Plus strand

Genomic View for PALM2AKAP2 Gene

Genes around PALM2AKAP2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PALM2AKAP2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PALM2AKAP2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PALM2AKAP2 Gene

Proteins for PALM2AKAP2 Gene

  • Protein details for PALM2AKAP2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8IXS6-PALM2_HUMAN
    Recommended name:
    Paralemmin-2
    Protein Accession:
    Q8IXS6
    Secondary Accessions:
    • A9Z1X9
    • Q8N9D5
    • Q96DU1

    Protein attributes for PALM2AKAP2 Gene

    Size:
    379 amino acids
    Molecular mass:
    42185 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAH39306.2; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for PALM2AKAP2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for PALM2AKAP2 Gene

Post-translational modifications for PALM2AKAP2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for PALM2AKAP2 Gene

Domains & Families for PALM2AKAP2 Gene

Gene Families for PALM2AKAP2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for PALM2AKAP2 Gene

Blocks:
InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

Q8IXS6

UniProtKB/Swiss-Prot:

PALM2_HUMAN :
  • Belongs to the paralemmin family.
Family:
  • Belongs to the paralemmin family.
genes like me logo Genes that share domains with PALM2AKAP2: view

No data available for Suggested Antigen Peptide Sequences for PALM2AKAP2 Gene

Function for PALM2AKAP2 Gene

Phenotypes From GWAS Catalog for PALM2AKAP2 Gene

genes like me logo Genes that share phenotypes with PALM2AKAP2: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PALM2AKAP2

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for PALM2AKAP2 Gene

Localization for PALM2AKAP2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PALM2AKAP2 Gene

Cell membrane; Lipid-anchor; Cytoplasmic side.

Gene Ontology (GO) - Cellular Components for PALM2AKAP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane IEA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with PALM2AKAP2: view

No data available for Subcellular locations from COMPARTMENTS and Subcellular locations from the Human Protein Atlas (HPA) for PALM2AKAP2 Gene

Pathways & Interactions for PALM2AKAP2 Gene

PathCards logo

SuperPathways for PALM2AKAP2 Gene

No Data Available

Interacting Proteins for PALM2AKAP2 Gene

Selected Interacting proteins: Q8IXS6-PALM2_HUMAN for PALM2AKAP2 Gene via IID

Gene Ontology (GO) - Biological Process for PALM2AKAP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008360 regulation of cell shape IEA --
genes like me logo Genes that share ontologies with PALM2AKAP2: view

No data available for Pathways by source and SIGNOR curated interactions for PALM2AKAP2 Gene

Drugs & Compounds for PALM2AKAP2 Gene

No Compound Related Data Available

Transcripts for PALM2AKAP2 Gene

mRNA/cDNA for PALM2AKAP2 Gene

(7) REFSEQ mRNAs :
(27) Additional mRNA sequences :
(5) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for PALM2AKAP2

Alternative Splicing Database (ASD) splice patterns (SP) for PALM2AKAP2 Gene

No ASD Table

Relevant External Links for PALM2AKAP2 Gene

GeneLoc Exon Structure for
PALM2AKAP2
ECgene alternative splicing isoforms for
PALM2AKAP2

Expression for PALM2AKAP2 Gene

mRNA Expression by UniProt/SwissProt for PALM2AKAP2 Gene:

Q8IXS6-PALM2_HUMAN
Tissue specificity: Expressed in infantile heart and muscle, and fibroblasts.

Primer Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for PALM2AKAP2 Gene

Orthologs for PALM2AKAP2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for PALM2AKAP2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PALM2 33
  • 100 (a)
ManyToMany
-- 33
  • 1 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia PALM2 33
  • 96 (a)
ManyToMany
AKAP2 32
  • 85.7 (n)
-- 33
ManyToMany
oppossum
(Monodelphis domestica)
Mammalia AKAP2 33
  • 26 (a)
OneToMany
mouse
(Mus musculus)
Mammalia Gm20459 33
  • 10 (a)
OneToMany
dog
(Canis familiaris)
Mammalia PALM2 33
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia AKAP2 33
OneToMany
chicken
(Gallus gallus)
Aves AKAP2 33
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 33
  • 12 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii palm2 33
  • 18 (a)
OneToMany
Species where no ortholog for PALM2AKAP2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PALM2AKAP2 Gene

ENSEMBL:
Gene Tree for PALM2AKAP2 (if available)
TreeFam:
Gene Tree for PALM2AKAP2 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PALM2AKAP2: view image

Paralogs for PALM2AKAP2 Gene

Paralogs for PALM2AKAP2 Gene

genes like me logo Genes that share paralogs with PALM2AKAP2: view

Variants for PALM2AKAP2 Gene

Sequence variations from dbSNP and Humsavar for PALM2AKAP2 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs193920924 uncertain-significance, Malignant tumor of prostate 110,136,169(+) G/A/T 5_prime_UTR_variant, coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, stop_gained
rs879255366 benign, not specified 110,048,736(+) CCCCCGGAGTCTCCTGGACCCCCGGAGTCTCCTGGACCCCCGGAG/CCCCCGGAGTCTCCTGGACCCCCGGAG/CCCCCGGAGTCTCCTGGACCCCCGGAGTCTCCTGGACCCCCGGAGTCTCCTGGACCCCCGGAG coding_sequence_variant, genic_downstream_transcript_variant, genic_upstream_transcript_variant, inframe_deletion, inframe_insertion, intron_variant
rs1000007811 -- 110,107,670(+) G/A genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000016585 -- 109,756,504(+) A/T genic_upstream_transcript_variant, intron_variant
rs1000023453 -- 109,757,273(+) C/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PALM2AKAP2 Gene

Variant ID Type Subtype PubMed ID
dgv2177e212 CNV loss 25503493
dgv494n21 CNV gain 19592680
esv1090209 CNV deletion 17803354
esv2075173 CNV deletion 18987734
esv2096560 CNV deletion 18987734
esv2195369 CNV deletion 18987734
esv2501710 CNV deletion 19546169
esv2619523 CNV deletion 19546169
esv2658904 CNV deletion 23128226
esv2672512 CNV deletion 23128226
esv2738915 CNV deletion 23290073
esv2738916 CNV deletion 23290073
esv2738919 CNV deletion 23290073
esv2738920 CNV deletion 23290073
esv2752274 CNV gain 17911159
esv28884 CNV loss 19812545
esv3309092 CNV mobile element insertion 20981092
esv3369203 CNV duplication 20981092
esv3413070 CNV insertion 20981092
esv3440538 CNV insertion 20981092
esv3573350 CNV loss 25503493
esv3621448 CNV gain 21293372
esv3621449 CNV gain 21293372
esv3621450 CNV gain 21293372
esv3621452 CNV loss 21293372
esv3621453 CNV gain 21293372
esv3621456 CNV gain 21293372
nsv1040651 CNV gain 25217958
nsv1043494 CNV gain 25217958
nsv1045508 CNV loss 25217958
nsv1076198 CNV deletion 25765185
nsv1113012 CNV deletion 24896259
nsv1117903 CNV deletion 24896259
nsv1124463 CNV deletion 24896259
nsv1125065 CNV duplication 24896259
nsv1128512 CNV deletion 24896259
nsv1132219 CNV deletion 24896259
nsv1136019 CNV deletion 24896259
nsv1137497 CNV deletion 24896259
nsv1141021 CNV deletion 24896259
nsv1148299 CNV deletion 26484159
nsv1150859 CNV deletion 26484159
nsv416423 CNV insertion 16902084
nsv428222 CNV loss 18775914
nsv466480 CNV loss 19166990
nsv466481 CNV gain 19166990
nsv471314 CNV loss 18288195
nsv471316 CNV gain 18288195
nsv476870 CNV novel sequence insertion 20440878
nsv478028 CNV novel sequence insertion 20440878
nsv499708 OTHER inversion 21111241
nsv515562 CNV gain 19592680
nsv524745 CNV gain 19592680
nsv527195 CNV loss 19592680
nsv615150 CNV loss 21841781
nsv615151 CNV gain 21841781
nsv7430 OTHER inversion 18451855
nsv831687 CNV gain 17160897
nsv831688 CNV gain+loss 17160897
nsv972441 CNV duplication 23825009

Variation tolerance for PALM2AKAP2 Gene

Residual Variation Intolerance Score: 79.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.59; 89.01% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PALM2AKAP2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
PALM2AKAP2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PALM2AKAP2 Gene

Disorders for PALM2AKAP2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for PALM2AKAP2 Gene - From: GeneCards

Disorder Aliases PubMed IDs
kallmann syndrome
  • hypogonadotropic hypogonadism and anosmia
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for PALM2AKAP2

genes like me logo Genes that share disorders with PALM2AKAP2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PALM2AKAP2 Gene

Publications for PALM2AKAP2 Gene

  1. The paralemmin protein family: identification of paralemmin-2, an isoform differentially spliced to AKAP2/AKAP-KL, and of palmdelphin, a more distant cytosolic relative. (PMID: 11478809) Hu B … Kilimann MW (Biochemical and biophysical research communications 2001) 2 3 4 56
  2. An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. (PMID: 24275569) Bian Y … Zou H (Journal of proteomics 2014) 3 4 56
  3. Evolution of the vertebrate paralemmin gene family: ancient origin of gene duplicates suggests distinct functions. (PMID: 22855693) Hultqvist G … Kilimann MW (PloS one 2012) 2 3 56
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56

Products for PALM2AKAP2 Gene

Sources for PALM2AKAP2 Gene