Free for academic non-profit institutions. Other users need a Commercial license
This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular... See more...
Aliases for OVGP1 Gene
Aliases for OVGP1 Gene
External Ids for OVGP1 Gene
- HGNC: 8524
- Entrez Gene: 5016
- Ensembl: ENSG00000085465
- OMIM: 603578
- UniProtKB: Q12889
Previous HGNC Symbols for OVGP1 Gene
- MUC9
Previous GeneCards Identifiers for OVGP1 Gene
- GC01M112373
- GC01M110828
- GC01M111002
- GC01M111255
- GC01M111668
- GC01M111758
- GC01M111956
- GC01M109828
Summaries for OVGP1 Gene
-
This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
GeneCards Summary for OVGP1 Gene
OVGP1 (Oviductal Glycoprotein 1) is a Protein Coding gene. Diseases associated with OVGP1 include Acute Salpingitis and Chronic Salpingitis. Among its related pathways are Fertilization. Gene Ontology (GO) annotations related to this gene include hydrolase activity, hydrolyzing O-glycosyl compounds and chitinase activity. An important paralog of this gene is CHIA.
UniProtKB/Swiss-Prot Summary for OVGP1 Gene
-
Binds to oocyte zona pellucida in vivo. May play a role in the fertilization process and/or early embryonic development.
No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for OVGP1 Gene
Genomics for OVGP1 Gene
GeneHancer (GH) Regulatory Elements for OVGP1 Gene
Promoters and enhancers for OVGP1 Gene
| GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
|---|---|---|---|---|---|---|---|---|---|---|
| GH01J111442 | Promoter | 0.6 | EPDnew | 750.4 | -14.9 | -14915 | 0.1 | JUNB BATF IRF4 | ENSG00000243960 OVGP1 C1orf162 DENND2D ENSG00000199890 WDR77 | |
| GH01J111427 | Promoter | 0.3 | EPDnew | 750.6 | +0.0 | 22 | 0.1 | OVGP1 lnc-WDR77-3 | ||
| GH01J111443 | Promoter | 0.3 | EPDnew | 750.4 | -13.5 | -13546 | 0.1 | ENSG00000243960 OVGP1 C1orf162 DENND2D lnc-ATP5PB-2 UBE2FP3 WDR77 | ||
| GH01J111445 | Promoter/Enhancer | 2 | EPDnew Ensembl ENCODE CraniofacialAtlas | 21 | -20.6 | -20648 | 5.2 | ZBTB40 SMARCE1 POLR2A USF2 HCFC1 ZNF362 MYC CC2D1A NFYC ELF1 | ATP5PB ENSG00000199890 WDR77 piR-50386 OVGP1 ENSG00000260948 DENND2D CEPT1 KRT18P57 RNU6-151P | |
| GH01J111469 | Promoter/Enhancer | 1.9 | EPDnew FANTOM5 Ensembl ENCODE dbSUPER | 11.7 | -46.4 | -46444 | 8.7 | ZNF24 SP1 MYC ETV6 RELA L3MBTL2 MAX NKRF NCOA3 BACH1 | C1orf162 NONHSAG002411.2 INKA2 ENSG00000260948 RAP1A OVGP1 WDR77 ATP5PB KRT18P57 RNU6-151P |
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around OVGP1 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the OVGP1 gene promoter:
-
- AREB6
- Ik-2
- Nkx2-5
- Nkx3-1
- Nkx3-1 v1
- Nkx3-1 v2
- Nkx3-1 v3
- Nkx3-1 v4
- Pbx1a
Genomic Locations for OVGP1 Gene
Genomic Locations for OVGP1 Gene
- chr1:111,414,314-111,427,777
- (GRCh38/hg38)
- Size:
- 13,464 bases
- Orientation:
- Minus strand
- chr1:111,956,936-111,970,399
- (GRCh37/hg19)
- Size:
- 13,464 bases
- Orientation:
- Minus strand
Genomic View for OVGP1 Gene
Genes around OVGP1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1p13.2 by HGNC
- 1p13.2 by Entrez Gene
- 1p13.2 by Ensembl
OVGP1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for OVGP1 Gene
Proteins for OVGP1 Gene
-
Protein details for OVGP1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q12889-OVGP1_HUMAN
- Recommended name:
- Oviduct-specific glycoprotein
- Protein Accession:
- Q12889
- A0AV19
- B9EGE1
- Q15841
Protein attributes for OVGP1 Gene
- Size:
- 678 amino acids
- Molecular mass:
- 75421 Da
- Quaternary structure:
- No Data Available
Protein Expression for OVGP1 Gene
Post-translational modifications for OVGP1 Gene
Other Protein References for OVGP1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Atlas Antibodies Anti-OVGP1 Antibody
- Creative Diagnostics Anti-OVGP1 monoclonal antibody, clone 4G0, Anti-OVGP1 (N-terminal) polyclonal antibody, and Anti-OVGP1 polyclonal antibody
-
Custom Antibody ServicesOriGene Antibodies for OVGP1
- Novus Biologicals Antibodies for OVGP1
-
Abcam antibodies for OVGP1
- Invitrogen Antibodies for OVGP1 (AFLGC-OVGP1)
-
Custom Antibody ServicesProSci Antibodies for OVGP1
-
Santa Cruz Biotechnology (SCBT) Antibodies for OVGP1
Protein Products
- Atlas Antibodies PrEST Antigen OVGP1
- Creative Biomart Recombinant Human OVGP1 and Recombinant Human OVGP1 293 Cell Lysate
-
OriGene Purified Proteins for OVGP1
- Search Origene for MassSpec and Protein Over-expression Lysates for OVGP1
- Origene Custom Protein Services for OVGP1
-
Abcam proteins for OVGP1
Assay Products
- G Biosciences Immunotag™ Oviduct-specific glycoprotein ELISA Kit
- Aviva Systems Biology OVGP1 ELISA Kit (Human) (OKEH07097)
No data available for DME Specific Peptides for OVGP1 Gene
Domains & Families for OVGP1 Gene
Gene Families for OVGP1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Plasma proteins
- Predicted secreted proteins
Protein Domains for OVGP1 Gene
Suggested Antigen Peptide Sequences for OVGP1 Gene
- GenScript: Design optimal peptide antigens:
-
- cDNA FLJ57304, highly similar to Oviduct-specific glycoprotein (B4DHP1_HUMAN)
- cDNA FLJ51043, highly similar to Oviduct-specific glycoprotein (B4DQD7_HUMAN)
- Oviductin (OVGP1_HUMAN)
- Oviduct glycoprotein (Q9UJZ3_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q12889- Family:
-
- Belongs to the glycosyl hydrolase 18 family.
Function for OVGP1 Gene
Molecular function for OVGP1 Gene
- UniProtKB/Swiss-Prot Function:
- Binds to oocyte zona pellucida in vivo. May play a role in the fertilization process and/or early embryonic development.
Phenotypes From GWAS Catalog for OVGP1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004568 | chitinase activity | IBA | 21873635 |
| GO:0008061 | chitin binding | IBA | 21873635 |
Phenotypes for OVGP1 Gene
- MGI mutant phenotypes for OVGP1:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for OVGP1:
Animal Models for OVGP1 Gene
- MGI Knock Outs for OVGP1:
-
- Ovgp1 Ovgp1<tm1Yar>
Animal Model Products
-
Taconic Biosciences Mouse Models for OVGP1
CRISPR Products
-
OriGene CRISPR knockouts for OVGP1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for OVGP1
- Applied Biological Materials (abm): CRISPR Clones for OVGP1 - Select products 50% OFF >
- * OVGP1 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * OVGP1 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for OVGP1
miRNA for OVGP1 Gene
- miRTarBase miRNAs that target OVGP1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for OVGP1
- Browse OriGene Inhibitory RNA Products For OVGP1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for OVGP1
Clone Products
- Sino Biological Human cDNA Clone for OVGP1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for OVGP1
- genomics-online: cdna clones - Search for available Osteogenic Growth Peptide (OGP) CDNA products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- orf clones - Search for available Osteogenic Growth Peptide (OGP) ORF products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- Applied Biological Materials (abm): Clones for OVGP1 - Select products 50% OFF >
- * OVGP1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * OVGP1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Cell Line Products
-
Horizon Cell Lines for OVGP1
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for OVGP1 Gene
Localization for OVGP1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for OVGP1 Gene
- Cytoplasmic vesicle, secretory vesicle. Note=Secretory granules.
| Compartment | Confidence |
|---|---|
| extracellular | 4 |
| cytosol | 4 |
| cytoskeleton | 1 |
| mitochondrion | 0 |
| nucleus | 0 |
| endoplasmic reticulum | 0 |
| lysosome | 0 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005576 | extracellular region | IBA | 21873635 |
| GO:0005737 | cytoplasm | IBA | 21873635 |
| GO:0005829 | cytosol | TAS | -- |
| GO:0030133 | transport vesicle | IEA | -- |
| GO:0031410 | cytoplasmic vesicle | IEA | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for OVGP1 Gene
Pathways & Interactions for OVGP1 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Fertilization |
1.00
1.00
|
|
Pathways by source for OVGP1 Gene
3 Reactome pathways for OVGP1 Gene
Interacting Proteins for OVGP1 Gene
GPS-Prot Interaction Network for OVGP1
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005975 | carbohydrate metabolic process | IEA | -- |
| GO:0006032 | chitin catabolic process | IBA | 21873635 |
| GO:0007338 | single fertilization | IEA | -- |
| GO:0007339 | binding of sperm to zona pellucida | TAS | -- |
| GO:0007565 | female pregnancy | TAS | 9341614 |
No data available for SIGNOR curated interactions for OVGP1 Gene
Drugs & Compounds for OVGP1 Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|
Drug Products
- Atlas Antibodies PrEST Antigen OVGP1
- Creative Biomart Recombinant Human OVGP1 and Recombinant Human OVGP1 293 Cell Lysate
Transcripts for OVGP1 Gene
mRNA/cDNA for OVGP1 Gene
- (1) REFSEQ mRNAs :
- (10) Additional mRNA sequences :
- (549) Selected AceView cDNA sequences:
- (3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000369732 2243 bps (ENST00000369732.3)
- ENST00000494622 482 bps (ENST00000494622.1)
- ENST00000481495 640 bps (ENST00000481495.1)
CRISPR Products
-
OriGene CRISPR knockouts for OVGP1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for OVGP1
- Applied Biological Materials (abm): CRISPR Clones for OVGP1 - Select products 50% OFF >
- * OVGP1 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * OVGP1 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for OVGP1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for OVGP1
- Browse OriGene Inhibitory RNA Products For OVGP1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for OVGP1
Clone Products
- Sino Biological Human cDNA Clone for OVGP1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for OVGP1
- genomics-online: cdna clones - Search for available Osteogenic Growth Peptide (OGP) CDNA products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- orf clones - Search for available Osteogenic Growth Peptide (OGP) ORF products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- Applied Biological Materials (abm): Clones for OVGP1 - Select products 50% OFF >
- * OVGP1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * OVGP1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
| ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | ^ | 3a | · | 3b | ^ | 4a | · | 4b | ^ | 5a | · | 5b | · | 5c | ^ | 6a | · | 6b | ^ | 7 | ^ | 8 | ^ | 9a | · | 9b | ^ | 10a | · | 10b | ^ | 11 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | ||||||||||||||||||||||||||||||||||||
| SP2: | - | ||||||||||||||||||||||||||||||||||||||
| SP3: | - | - | - | - | - | ||||||||||||||||||||||||||||||||||
| SP4: | - | - | - | - | |||||||||||||||||||||||||||||||||||
| SP5: | - | ||||||||||||||||||||||||||||||||||||||
| SP6: | |||||||||||||||||||||||||||||||||||||||
| SP7: |
Expression for OVGP1 Gene
mRNA differential expression in normal tissues according to GTEx for OVGP1 Gene
This gene is overexpressed in Fallopian Tube (x9.6).
This gene is overexpressed in Cervix (43.9) and Ovary (23.9).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for OVGP1 Gene
NURSA nuclear receptor signaling pathways regulating expression of OVGP1 Gene:
OVGP1SOURCE GeneReport for Unigene cluster for OVGP1 Gene:
Hs.1154mRNA Expression by UniProt/SwissProt for OVGP1 Gene:
Q12889-OVGP1_HUMAN
Tissue specificity:
Oviduct.
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for OVGP1 Gene
Orthologs for OVGP1 Gene
This gene was present in the common ancestor of animals and fungi.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | OVGP1 33 32 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | -- 33 |
|
OneToMany | |
| LOC100138271 32 |
|
||||
| OVGP1 33 |
|
OneToMany | |||
| dog (Canis familiaris) |
Mammalia | OVGP1 33 32 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Ovgp1 17 33 32 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | OVGP1 33 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | OVGP1 33 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | OVGP1 33 |
|
OneToOne | |
| zebrafish (Danio rerio) |
Actinopterygii | OVGP1 (3 of 4) 33 |
|
OneToMany | |
| chia.3 33 |
|
OneToMany | |||
| chia.4 33 |
|
OneToMany | |||
| chia.6 33 |
|
OneToMany | |||
| fruit fly (Drosophila melanogaster) |
Insecta | CG9357 34 |
|
|
|
| CG10531 34 |
|
|
|||
| Cht2 34 |
|
|
|||
| Cht3 34 |
|
|
|||
| CG3044 34 |
|
|
|||
| Cht7 33 |
|
OneToMany | |||
| worm (Caenorhabditis elegans) |
Secernentea | cht-1 33 |
|
OneToMany | |
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | CTS2 33 |
|
OneToMany | |
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.8046 33 |
|
OneToMany |
- Species where no ortholog for OVGP1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rat (Rattus norvegicus)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- tropical clawed frog (Silurana tropicalis)
- wheat (Triticum aestivum)
Evolution for OVGP1 Gene
- ENSEMBL:
- Gene Tree for OVGP1 (if available)
- TreeFam:
- Gene Tree for OVGP1 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for OVGP1: view image
Paralogs for OVGP1 Gene
Variants for OVGP1 Gene
| SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| VAR_035752 | A colorectal cancer sample | p.Leu662His | |||
| rs879255376 | benign, not specified | 111,414,902(-) | GGTCA/GGTCAGGGTCTTCTGTCCAGTGGTCA | coding_sequence_variant, inframe_insertion | |
| rs1000226065 | -- | 111,413,947(-) | C/A | downstream_transcript_variant | |
| rs1000553772 | -- | 111,426,644(-) | G/A | intron_variant | |
| rs1001132132 | -- | 111,420,367(-) | C/T | intron_variant |
Residual Variation Intolerance Score:
88.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
9.99;
89.97% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for OVGP1 Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OVGP1 Gene
Disorders for OVGP1 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| acute salpingitis |
|
|
| chronic salpingitis |
|
|
| taylor's syndrome |
|
|
| salpingitis |
|
|
| inclusion conjunctivitis |
|
|
Search OVGP1 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for OVGP1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for OVGP1 Gene
Publications for OVGP1 Gene
- Complementary deoxyribonucleic acid cloning and molecular characterization of an estrogen-dependent human oviductal glycoprotein. (PMID: 7819450) Arias EB … Jaffe RC (Biology of reproduction 1994) 2 3 4 23 56
- Allelic polymorphism and chromosomal localization of the human oviductin gene (MUC9). (PMID: 9341614) Lapensée L … Bleau G (Fertility and sterility 1997) 2 3 23 56
- Investigation of genetic susceptibility factors for human longevity - a targeted nonsynonymous SNP study. (PMID: 20800603) Flachsbart F … Nebel A (Mutation research 2010) 3 43 56
- Oviductal glycoprotein (OVGP1, MUC9): a differentiation-based mucin present in serum of women with ovarian cancer. (PMID: 20130498) Maines-Bandiera S … Auersperg N (International journal of gynecological cancer : official journal of the International Gynecological Cancer Society 2010) 3 23 56
- The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 56
ExternalLinks
Products for OVGP1 Gene
- Custom Antibody ServicesOriGene Antibodies for OVGP1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for OVGP1
- Search Origene for MassSpec and Protein Over-expression Lysates for OVGP1
- Origene Custom Protein Services for OVGP1
- Origene sirna, shrna, and RNAi products in human, mouse, rat for OVGP1
- Browse OriGene Inhibitory RNA Products For OVGP1
- OriGene qPCR primer pairs for OVGP1
- OriGene CRISPR knockouts for OVGP1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For OVGP1
- Sino Biological Human cDNA Clone for OVGP1
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for OVGP1
- Novus Biologicals proteins and lysates for OVGP1
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for OVGP1
- Abcam proteins for OVGP1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Taconic Biosciences Mouse Models for OVGP1
- Find your next knockout model in the Taconic Knockout Repository
- Genetically Engineered Models Available Immediately
- Humanized Mice
- Invitrogen Antibodies for OVGP1 (AFLGC-OVGP1)
- antibodies-online: Show 17 available Osteogenic Growth Peptide (OGP) Antibodies ranked by validation data
- Compare Top Osteogenic Growth Peptide (OGP) Antibodies
- antibodies-online: Show 15 available Osteogenic Growth Peptide (OGP) Elisa Kits ranked by validation data
- Compare Top Osteogenic Growth Peptide (OGP) Elisa Kits
- Quality Products:
- antibodies-online: Show 6 available Osteogenic Growth Peptide (OGP) Proteins ranked by validation data
- Compare Top Osteogenic Growth Peptide (OGP) Proteins
- Quality Products:
- Santa Cruz Biotechnology (SCBT) Antibodies for OVGP1
- Search Santa Cruz Biotechnology (SCBT) for OVGP1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for OVGP1
- Custom Antibody ServicesProSci Antibodies for OVGP1
- Search for OVGP1 Proteins at ProSci
- Horizon Cell Lines for OVGP1
- genomics-online: cdna clones - Search for available Osteogenic Growth Peptide (OGP) CDNA products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- orf clones - Search for available Osteogenic Growth Peptide (OGP) ORF products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- genomics-online: gRNA clones - Search for available Osteogenic Growth Peptide (OGP) gRNA products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- genomics-online: primer clones - Search for available Osteogenic Growth Peptide (OGP) Primer products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- genomics-online: shRNA clones - Search for available Osteogenic Growth Peptide (OGP) shRNA products
- Overview of 54 available Osteogenic Growth Peptide (OGP) gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for OVGP1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for OVGP1
- Search GeneCopoeia for miRNA 3'UTR Target clone products for OVGP1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for OVGP1
Sources for OVGP1 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource