This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular... See more...

Aliases for OVGP1 Gene

Aliases for OVGP1 Gene

  • Oviductal Glycoprotein 1 2 3 5
  • Oviductin 2 3 4
  • Estrogen-Dependent Oviduct Protein 3 4
  • Oviductal Glycoprotein 1, 120kDa 2 3
  • Oviduct-Specific Glycoprotein 3 4
  • Mucin 9 2 3
  • MUC9 3 4
  • OGP 3 4
  • Oviductal Glycoprotein 4
  • Oviduct Glycoprotein 3
  • Mucin-9 4
  • CHIT5 3
  • EGP 3

External Ids for OVGP1 Gene

Previous HGNC Symbols for OVGP1 Gene

  • MUC9

Previous GeneCards Identifiers for OVGP1 Gene

  • GC01M112373
  • GC01M110828
  • GC01M111002
  • GC01M111255
  • GC01M111668
  • GC01M111758
  • GC01M111956
  • GC01M109828

Summaries for OVGP1 Gene

Entrez Gene Summary for OVGP1 Gene

  • This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]

GeneCards Summary for OVGP1 Gene

OVGP1 (Oviductal Glycoprotein 1) is a Protein Coding gene. Diseases associated with OVGP1 include Acute Salpingitis and Chronic Salpingitis. Among its related pathways are Fertilization. Gene Ontology (GO) annotations related to this gene include hydrolase activity, hydrolyzing O-glycosyl compounds and chitinase activity. An important paralog of this gene is CHIA.

UniProtKB/Swiss-Prot Summary for OVGP1 Gene

  • Binds to oocyte zona pellucida in vivo. May play a role in the fertilization process and/or early embryonic development.

Gene Wiki entry for OVGP1 Gene

Additional gene information for OVGP1 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for OVGP1 Gene

Genomics for OVGP1 Gene

GeneHancer (GH) Regulatory Elements for OVGP1 Gene

Promoters and enhancers for OVGP1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J111442 Promoter 0.6 EPDnew 750.4 -14.9 -14915 0.1 JUNB BATF IRF4 ENSG00000243960 OVGP1 C1orf162 DENND2D ENSG00000199890 WDR77
GH01J111427 Promoter 0.3 EPDnew 750.6 +0.0 22 0.1 OVGP1 lnc-WDR77-3
GH01J111443 Promoter 0.3 EPDnew 750.4 -13.5 -13546 0.1 ENSG00000243960 OVGP1 C1orf162 DENND2D lnc-ATP5PB-2 UBE2FP3 WDR77
GH01J111445 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 21 -20.6 -20648 5.2 ZBTB40 SMARCE1 POLR2A USF2 HCFC1 ZNF362 MYC CC2D1A NFYC ELF1 ATP5PB ENSG00000199890 WDR77 piR-50386 OVGP1 ENSG00000260948 DENND2D CEPT1 KRT18P57 RNU6-151P
GH01J111469 Promoter/Enhancer 1.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.7 -46.4 -46444 8.7 ZNF24 SP1 MYC ETV6 RELA L3MBTL2 MAX NKRF NCOA3 BACH1 C1orf162 NONHSAG002411.2 INKA2 ENSG00000260948 RAP1A OVGP1 WDR77 ATP5PB KRT18P57 RNU6-151P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around OVGP1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the OVGP1 gene promoter:
  • AREB6
  • Ik-2
  • Nkx2-5
  • Nkx3-1
  • Nkx3-1 v1
  • Nkx3-1 v2
  • Nkx3-1 v3
  • Nkx3-1 v4
  • Pbx1a

Genomic Locations for OVGP1 Gene

Genomic Locations for OVGP1 Gene
chr1:111,414,314-111,427,777
(GRCh38/hg38)
Size:
13,464 bases
Orientation:
Minus strand
chr1:111,956,936-111,970,399
(GRCh37/hg19)
Size:
13,464 bases
Orientation:
Minus strand

Genomic View for OVGP1 Gene

Genes around OVGP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
OVGP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for OVGP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for OVGP1 Gene

Proteins for OVGP1 Gene

  • Protein details for OVGP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q12889-OVGP1_HUMAN
    Recommended name:
    Oviduct-specific glycoprotein
    Protein Accession:
    Q12889
    Secondary Accessions:
    • A0AV19
    • B9EGE1
    • Q15841

    Protein attributes for OVGP1 Gene

    Size:
    678 amino acids
    Molecular mass:
    75421 Da
    Quaternary structure:
    No Data Available

neXtProt entry for OVGP1 Gene

Post-translational modifications for OVGP1 Gene

  • Glycosylation at Asn402, Asn441, Asn580, Asn596, and Asn648
  • Modification sites at PhosphoSitePlus

Other Protein References for OVGP1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for OVGP1 Gene

Domains & Families for OVGP1 Gene

Gene Families for OVGP1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for OVGP1 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ57304, highly similar to Oviduct-specific glycoprotein (B4DHP1_HUMAN)
  • cDNA FLJ51043, highly similar to Oviduct-specific glycoprotein (B4DQD7_HUMAN)
  • Oviductin (OVGP1_HUMAN)
  • Oviduct glycoprotein (Q9UJZ3_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q12889

UniProtKB/Swiss-Prot:

OVGP1_HUMAN :
  • Belongs to the glycosyl hydrolase 18 family.
Family:
  • Belongs to the glycosyl hydrolase 18 family.
genes like me logo Genes that share domains with OVGP1: view

Function for OVGP1 Gene

Molecular function for OVGP1 Gene

UniProtKB/Swiss-Prot Function:
Binds to oocyte zona pellucida in vivo. May play a role in the fertilization process and/or early embryonic development.

Phenotypes From GWAS Catalog for OVGP1 Gene

Gene Ontology (GO) - Molecular Function for OVGP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004568 chitinase activity IBA 21873635
GO:0008061 chitin binding IBA 21873635
genes like me logo Genes that share ontologies with OVGP1: view
genes like me logo Genes that share phenotypes with OVGP1: view

Animal Models for OVGP1 Gene

MGI Knock Outs for OVGP1:

Animal Model Products

  • Taconic Biosciences Mouse Models for OVGP1

CRISPR Products

miRNA for OVGP1 Gene

miRTarBase miRNAs that target OVGP1

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for OVGP1 Gene

Localization for OVGP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for OVGP1 Gene

Cytoplasmic vesicle, secretory vesicle. Note=Secretory granules.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for OVGP1 gene
Compartment Confidence
extracellular 4
cytosol 4
cytoskeleton 1
mitochondrion 0
nucleus 0
endoplasmic reticulum 0
lysosome 0

Gene Ontology (GO) - Cellular Components for OVGP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IBA 21873635
GO:0005737 cytoplasm IBA 21873635
GO:0005829 cytosol TAS --
GO:0030133 transport vesicle IEA --
GO:0031410 cytoplasmic vesicle IEA --
genes like me logo Genes that share ontologies with OVGP1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for OVGP1 Gene

Pathways & Interactions for OVGP1 Gene

PathCards logo

SuperPathways for OVGP1 Gene

SuperPathway Contained pathways
1 Fertilization
genes like me logo Genes that share pathways with OVGP1: view

Pathways by source for OVGP1 Gene

Gene Ontology (GO) - Biological Process for OVGP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005975 carbohydrate metabolic process IEA --
GO:0006032 chitin catabolic process IBA 21873635
GO:0007338 single fertilization IEA --
GO:0007339 binding of sperm to zona pellucida TAS --
GO:0007565 female pregnancy TAS 9341614
genes like me logo Genes that share ontologies with OVGP1: view

No data available for SIGNOR curated interactions for OVGP1 Gene

Drugs & Compounds for OVGP1 Gene

(3) Drugs for OVGP1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with OVGP1: view

Transcripts for OVGP1 Gene

mRNA/cDNA for OVGP1 Gene

(1) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(549) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for OVGP1 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b · 5c ^ 6a · 6b ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11
SP1: - - -
SP2: -
SP3: - - - - -
SP4: - - - -
SP5: -
SP6:
SP7:

Relevant External Links for OVGP1 Gene

GeneLoc Exon Structure for
OVGP1
ECgene alternative splicing isoforms for
OVGP1

Expression for OVGP1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for OVGP1 Gene

mRNA differential expression in normal tissues according to GTEx for OVGP1 Gene

This gene is overexpressed in Fallopian Tube (x9.6).

Protein differential expression in normal tissues from HIPED for OVGP1 Gene

This gene is overexpressed in Cervix (43.9) and Ovary (23.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for OVGP1 Gene



Protein tissue co-expression partners for OVGP1 Gene

NURSA nuclear receptor signaling pathways regulating expression of OVGP1 Gene:

OVGP1

SOURCE GeneReport for Unigene cluster for OVGP1 Gene:

Hs.1154

mRNA Expression by UniProt/SwissProt for OVGP1 Gene:

Q12889-OVGP1_HUMAN
Tissue specificity: Oviduct.
genes like me logo Genes that share expression patterns with OVGP1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for OVGP1 Gene

Orthologs for OVGP1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for OVGP1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia OVGP1 33 32
  • 99.25 (n)
OneToOne
cow
(Bos Taurus)
Mammalia -- 33
  • 80 (a)
OneToMany
LOC100138271 32
  • 79.6 (n)
OVGP1 33
  • 71 (a)
OneToMany
dog
(Canis familiaris)
Mammalia OVGP1 33 32
  • 79.37 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Ovgp1 17 33 32
  • 74 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia OVGP1 33
  • 53 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia OVGP1 33
  • 46 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia OVGP1 33
  • 43 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii OVGP1 (3 of 4) 33
  • 45 (a)
OneToMany
chia.3 33
  • 42 (a)
OneToMany
chia.4 33
  • 40 (a)
OneToMany
chia.6 33
  • 40 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta CG9357 34
  • 38 (a)
CG10531 34
  • 35 (a)
Cht2 34
  • 35 (a)
Cht3 34
  • 35 (a)
CG3044 34
  • 30 (a)
Cht7 33
  • 19 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea cht-1 33
  • 28 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CTS2 33
  • 20 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8046 33
  • 23 (a)
OneToMany
Species where no ortholog for OVGP1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for OVGP1 Gene

ENSEMBL:
Gene Tree for OVGP1 (if available)
TreeFam:
Gene Tree for OVGP1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for OVGP1: view image

Paralogs for OVGP1 Gene

Paralogs for OVGP1 Gene

(4) SIMAP similar genes for OVGP1 Gene using alignment to 2 proteins:

  • OVGP1_HUMAN
  • B4DHP1_HUMAN
genes like me logo Genes that share paralogs with OVGP1: view

Variants for OVGP1 Gene

Sequence variations from dbSNP and Humsavar for OVGP1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
VAR_035752 A colorectal cancer sample p.Leu662His
rs879255376 benign, not specified 111,414,902(-) GGTCA/GGTCAGGGTCTTCTGTCCAGTGGTCA coding_sequence_variant, inframe_insertion
rs1000226065 -- 111,413,947(-) C/A downstream_transcript_variant
rs1000553772 -- 111,426,644(-) G/A intron_variant
rs1001132132 -- 111,420,367(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for OVGP1 Gene

Variant ID Type Subtype PubMed ID
dgv12e215 CNV deletion 23714750
esv2100138 CNV deletion 18987734
esv2716218 CNV deletion 23290073
nsv463250 CNV loss 19166990
nsv547535 CNV loss 21841781
nsv824131 CNV loss 20364138

Variation tolerance for OVGP1 Gene

Residual Variation Intolerance Score: 88.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.99; 89.97% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for OVGP1 Gene

Human Gene Mutation Database (HGMD)
OVGP1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
OVGP1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OVGP1 Gene

Disorders for OVGP1 Gene

MalaCards: The human disease database

(7) MalaCards diseases for OVGP1 Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
acute salpingitis
chronic salpingitis
taylor's syndrome
  • congestion-fibrosis syndrome
salpingitis
inclusion conjunctivitis
  • adult inclusion conjunctivitis
- elite association - COSMIC cancer census association via MalaCards
Search OVGP1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for OVGP1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with OVGP1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for OVGP1 Gene

Publications for OVGP1 Gene

  1. Complementary deoxyribonucleic acid cloning and molecular characterization of an estrogen-dependent human oviductal glycoprotein. (PMID: 7819450) Arias EB … Jaffe RC (Biology of reproduction 1994) 2 3 4 23 56
  2. Allelic polymorphism and chromosomal localization of the human oviductin gene (MUC9). (PMID: 9341614) Lapensée L … Bleau G (Fertility and sterility 1997) 2 3 23 56
  3. Investigation of genetic susceptibility factors for human longevity - a targeted nonsynonymous SNP study. (PMID: 20800603) Flachsbart F … Nebel A (Mutation research 2010) 3 43 56
  4. Oviductal glycoprotein (OVGP1, MUC9): a differentiation-based mucin present in serum of women with ovarian cancer. (PMID: 20130498) Maines-Bandiera S … Auersperg N (International journal of gynecological cancer : official journal of the International Gynecological Cancer Society 2010) 3 23 56
  5. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 56

Products for OVGP1 Gene

Sources for OVGP1 Gene