Free for academic non-profit institutions. Other users need a Commercial license

Aliases for OR52K1 Gene

Aliases for OR52K1 Gene

  • Olfactory Receptor Family 52 Subfamily K Member 1 2 3 5
  • Olfactory Receptor OR11-8 3 4
  • Olfactory Receptor, Family 52, Subfamily K, Member 1 2
  • Olfactory Receptor 52K1 3
  • OR11-8 3

External Ids for OR52K1 Gene

Previous GeneCards Identifiers for OR52K1 Gene

  • GC11U990492
  • GC11P004475
  • GC11P004466

Summaries for OR52K1 Gene

Entrez Gene Summary for OR52K1 Gene

  • Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

GeneCards Summary for OR52K1 Gene

OR52K1 (Olfactory Receptor Family 52 Subfamily K Member 1) is a Protein Coding gene. Among its related pathways are Signaling by GPCR and Olfactory Signaling Pathway. Gene Ontology (GO) annotations related to this gene include G-protein coupled receptor activity and olfactory receptor activity. An important paralog of this gene is OR52K2.

UniProtKB/Swiss-Prot for OR52K1 Gene

  • Odorant receptor.

Gene Wiki entry for OR52K1 Gene

Additional gene information for OR52K1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for OR52K1 Gene

Genomics for OR52K1 Gene

GeneHancer (GH) Regulatory Elements for OR52K1 Gene

Promoters and enhancers for OR52K1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11I004480 Enhancer 0.8 Ensembl ENCODE 550.8 -1.6 -1641 1.5 JUN DPF2 ZFP69B FOSL1 JUND ZNF316 ZNF692 PRDM10 NFE2 FOS OR52K1 GC11M004470
GH11I004484 Enhancer 0.2 FANTOM5 556.6 +1.8 1828 0.1 OR52K1 TRIM21 OR51F2 OR52K2 OR51D1 OR51T1 OR51G1 OR52M2P
GH11I004455 Enhancer 1 FANTOM5 Ensembl ENCODE 10.9 -27.0 -26982 0.7 CTCF POLR2A GABPB1 MAX ETV6 MYC GABPA OR52K3P OR52K1 TRIM21 OR52K2
GH11I004458 Enhancer 0.9 FANTOM5 Ensembl ENCODE 12.1 -22.3 -22324 3.7 CEBPG SPI1 OR52K3P OR52K1 OR52M1 TRIM21 OR52K2
GH11I004182 Enhancer 0.7 ENCODE 10.8 -300.4 -300370 0.1 BCOR HDGF CTCF RB1 ETV1 MAX RAD21 CTBP1 ZNF143 SMC3 OR52K3P OR52K1 LOC100506082 OR55B1P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around OR52K1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the OR52K1 gene promoter:

Genomic Locations for OR52K1 Gene

Genomic Locations for OR52K1 Gene
10,852 bases
Plus strand

Genomic View for OR52K1 Gene

Genes around OR52K1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
OR52K1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for OR52K1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for OR52K1 Gene

Proteins for OR52K1 Gene

  • Protein details for OR52K1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Olfactory receptor 52K1
    Protein Accession:
    Secondary Accessions:
    • B9EH54
    • Q6IFK5

    Protein attributes for OR52K1 Gene

    314 amino acids
    Molecular mass:
    35231 Da
    Quaternary structure:
    No Data Available

neXtProt entry for OR52K1 Gene

Post-translational modifications for OR52K1 Gene

  • Glycosylation at Asn5
  • Modification sites at PhosphoSitePlus

Other Protein References for OR52K1 Gene

ENSEMBL proteins:
REFSEQ proteins:
HORDE protein sequence:

No data available for DME Specific Peptides for OR52K1 Gene

Domains & Families for OR52K1 Gene

Gene Families for OR52K1 Gene

Human Protein Atlas (HPA):
  • G-protein coupled receptors
  • Predicted membrane proteins

Protein Domains for OR52K1 Gene

Suggested Antigen Peptide Sequences for OR52K1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the G-protein coupled receptor 1 family.
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with OR52K1: view

Function for OR52K1 Gene

Molecular function for OR52K1 Gene

UniProtKB/Swiss-Prot Function:
Odorant receptor.

Phenotypes From GWAS Catalog for OR52K1 Gene

Gene Ontology (GO) - Molecular Function for OR52K1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004930 G-protein coupled receptor activity IEA --
GO:0004984 olfactory receptor activity IBA --
genes like me logo Genes that share ontologies with OR52K1: view

Phenotypes for OR52K1 Gene

GenomeRNAi human phenotypes for OR52K1:
genes like me logo Genes that share phenotypes with OR52K1: view

miRNA for OR52K1 Gene

miRTarBase miRNAs that target OR52K1

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for OR52K1 Gene

Localization for OR52K1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for OR52K1 Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for OR52K1 gene
Compartment Confidence
plasma membrane 5

Gene Ontology (GO) - Cellular Components for OR52K1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS,IBA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with OR52K1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for OR52K1 Gene

Pathways & Interactions for OR52K1 Gene

genes like me logo Genes that share pathways with OR52K1: view

Pathways by source for OR52K1 Gene

Interacting Proteins for OR52K1 Gene

Gene Ontology (GO) - Biological Process for OR52K1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction IBA --
GO:0007186 G-protein coupled receptor signaling pathway TAS --
GO:0007608 sensory perception of smell IEA --
GO:0050896 response to stimulus IEA --
GO:0050911 detection of chemical stimulus involved in sensory perception of smell IEA --
genes like me logo Genes that share ontologies with OR52K1: view

No data available for SIGNOR curated interactions for OR52K1 Gene

Drugs & Compounds for OR52K1 Gene

No Compound Related Data Available

Transcripts for OR52K1 Gene

mRNA/cDNA for OR52K1 Gene

(1) REFSEQ mRNAs :
(1) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for OR52K1 Gene

No ASD Table

Relevant External Links for OR52K1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for OR52K1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for OR52K1 Gene

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for OR52K1 Gene

NURSA nuclear receptor signaling pathways regulating expression of OR52K1 Gene:


SOURCE GeneReport for Unigene cluster for OR52K1 Gene:

genes like me logo Genes that share expression patterns with OR52K1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for OR52K1 Gene

Orthologs for OR52K1 Gene

This gene was present in the common ancestor of mammals.

Orthologs for OR52K1 Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia OR52K1 34
  • 90 (a)
cOR52K6 33
  • 89.78 (n)
(Bos Taurus)
Mammalia OR52K1 33 34
  • 87.79 (n)
(Rattus norvegicus)
Mammalia Olr46 33
  • 86.24 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 78 (a)
-- 34
  • 75 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 53 (a)
(Mus musculus)
Mammalia Olfr656 34
  • 50 (a)
Species where no ortholog for OR52K1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for OR52K1 Gene

Gene Tree for OR52K1 (if available)
Gene Tree for OR52K1 (if available)

Paralogs for OR52K1 Gene

Paralogs for OR52K1 Gene

(456) SIMAP similar genes for OR52K1 Gene using alignment to 1 proteins: Pseudogenes for OR52K1 Gene

genes like me logo Genes that share paralogs with OR52K1: view

Variants for OR52K1 Gene

Sequence variations from dbSNP and Humsavar for OR52K1 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1001250322 -- 4,488,838(+) TAGAAGGTATATATAGAAGGT/TAGAAGGT upstream_transcript_variant
rs1001721149 -- 4,489,043(+) T/G coding_sequence_variant, missense_variant
rs1002060051 -- 4,487,851(+) ATATAT/ATAT upstream_transcript_variant
rs1002113674 -- 4,487,557(+) C/A upstream_transcript_variant
rs1002608911 -- 4,488,439(+) T/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for OR52K1 Gene

Variant ID Type Subtype PubMed ID
dgv1583n54 CNV loss 21841781
dgv38e55 CNV loss 17911159
dgv55n21 CNV loss 19592680
esv2668112 CNV deletion 23128226
esv2759797 CNV gain+loss 17122850
esv2759798 CNV loss 17122850
esv3625179 CNV loss 21293372
esv3625186 CNV loss 21293372
nsv1039640 CNV loss 25217958
nsv1048094 CNV loss 25217958
nsv428248 CNV gain+loss 18775914
nsv442215 CNV loss 18776908
nsv553159 CNV gain 21841781
nsv825722 CNV loss 20364138
nsv971979 CNV duplication 23825009

Variation tolerance for OR52K1 Gene

Residual Variation Intolerance Score: 69.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.46; 85.74% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for OR52K1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OR52K1 Gene

Disorders for OR52K1 Gene

Additional Disease Information for OR52K1

No disorders were found for OR52K1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for OR52K1 Gene

Publications for OR52K1 Gene

  1. The human olfactory receptor gene family. (PMID: 14983052) Malnic B … Buck LB (Proceedings of the National Academy of Sciences of the United States of America 2004) 3 4 58
  2. A high-density genome-wide association screen of sporadic ALS in US veterans. (PMID: 22470424) Kwee LC … Hauser MA (PloS one 2012) 3 58
  3. Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (PMID: 23251661) Comuzzie AG … Butte NF (PloS one 2012) 3 58
  4. Human chromosome 11 DNA sequence and analysis including novel gene identification. (PMID: 16554811) Taylor TD … Sakaki Y (Nature 2006) 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58

Products for OR52K1 Gene

Sources for OR52K1 Gene

Loading form....