Free for academic non-profit institutions. Other users need a Commercial license

Aliases for OARD1 Gene

Aliases for OARD1 Gene

  • O-Acyl-ADP-Ribose Deacylase 1 2 3 5
  • Terminal ADP-Ribose Protein Glycohydrolase 1 2 3
  • C6orf130 3 4
  • O-Acetyl-ADP-Ribose Deacetylase C6orf130 3
  • Chromosome 6 Open Reading Frame 130 2
  • O-Acetyl-ADP-Ribose Deacetylase 1 3
  • EC 3.5.1.- 4
  • DJ34B21.3 3
  • TARG1 3

External Ids for OARD1 Gene

Previous HGNC Symbols for OARD1 Gene

  • C6orf130

Summaries for OARD1 Gene

Entrez Gene Summary for OARD1 Gene

  • The protein encoded by this gene is a deacylase that can convert O-acetyl-ADP-ribose to ADP-ribose and acetate, O-propionyl-ADP-ribose to ADP-ribose and propionate, and O-butyryl-ADP-ribose to ADP-ribose and butyrate. The ADP-ribose product is able to inhibit these reactions through a competitive feedback loop. [provided by RefSeq, Jul 2016]

GeneCards Summary for OARD1 Gene

OARD1 (O-Acyl-ADP-Ribose Deacylase 1) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include deacetylase activity and purine nucleoside binding.

UniProtKB/Swiss-Prot for OARD1 Gene

  • Deacetylates O-acetyl-ADP ribose, a signaling molecule generated by the deacetylation of acetylated lysine residues in histones and other proteins. Catalyzes the deacylation of O-acetyl-ADP-ribose, O-propionyl-ADP-ribose and O-butyryl-ADP-ribose, yielding ADP-ribose plus acetate, propionate and butyrate, respectively.

Additional gene information for OARD1 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for OARD1 Gene

Genomics for OARD1 Gene

GeneHancer (GH) Regulatory Elements for OARD1 Gene

Promoters and enhancers for OARD1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06I041070 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 550.3 +24.2 24203 5.9 MLX FEZF1 DMAP1 IRF4 YY1 E2F8 ZNF143 SP3 NFYC ZNF610 NFYA OARD1 ADCY10P1 TAF8 FRS3 UNC5CL TSPO2 APOBEC2
GH06I041097 Enhancer 0.4 ENCODE 550.8 -0.1 -143 1.4 NFIC JUN OARD1 PIR45100 GC06P042014 NFYA
GH06I041455 Enhancer 1.2 ENCODE dbSUPER 12 -358.7 -358742 2.6 HDGF PKNOX1 FOXA2 ZFP64 ARID4B YBX1 FEZF1 ZNF2 ZBTB7B SLC30A9 MED20 TAF8 OARD1 FOXP4 FOXP4-AS1 NFYA ENSG00000124593 GC06M041477 ENSG00000280371
GH06I041766 Enhancer 1.2 Ensembl ENCODE 12 -670.3 -670313 3.3 HDGF PKNOX1 SMAD1 FOXA2 FEZF1 ZNF2 ZNF213 ZNF302 KLF13 SP3 MED20 OARD1 C6orf132 MDFI USP49 PGC ENSG00000124593 ENSG00000269387 PIR31477
GH06I041051 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE dbSUPER 0.3 +42.0 41982 8.5 PKNOX1 ATF1 FOXA2 ZNF48 ZNF766 ATF7 NCOA1 MEF2D MIER3 SMARCA4 APOBEC2 ADCY10P1 TREML3P NFYA OARD1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around OARD1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for OARD1 Gene

Genomic Locations for OARD1 Gene
64,161 bases
Minus strand

Genomic View for OARD1 Gene

Genes around OARD1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
OARD1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for OARD1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for OARD1 Gene

Proteins for OARD1 Gene

  • Protein details for OARD1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    O-acetyl-ADP-ribose deacetylase 1
    Protein Accession:
    Secondary Accessions:
    • A6NEK4
    • A8K4H4
    • Q96F23

    Protein attributes for OARD1 Gene

    152 amino acids
    Molecular mass:
    17025 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for OARD1 Gene

neXtProt entry for OARD1 Gene

Post-translational modifications for OARD1 Gene

  • Ubiquitination at isoforms=104
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for OARD1 Gene

Domains & Families for OARD1 Gene

Gene Families for OARD1 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for OARD1 Gene

Suggested Antigen Peptide Sequences for OARD1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with OARD1: view

No data available for UniProtKB/Swiss-Prot for OARD1 Gene

Function for OARD1 Gene

Molecular function for OARD1 Gene

UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=182 uM for O-acetyl-ADP-ribose {ECO:0000269 PubMed:21849506};
UniProtKB/Swiss-Prot EnzymeRegulation:
Subject to competitive inhibition by the product ADP-ribose.
UniProtKB/Swiss-Prot Function:
Deacetylates O-acetyl-ADP ribose, a signaling molecule generated by the deacetylation of acetylated lysine residues in histones and other proteins. Catalyzes the deacylation of O-acetyl-ADP-ribose, O-propionyl-ADP-ribose and O-butyryl-ADP-ribose, yielding ADP-ribose plus acetate, propionate and butyrate, respectively.

Enzyme Numbers (IUBMB) for OARD1 Gene

Phenotypes From GWAS Catalog for OARD1 Gene

Gene Ontology (GO) - Molecular Function for OARD1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001883 purine nucleoside binding IDA 21849506
GO:0005515 protein binding IPI 23481255
GO:0016787 hydrolase activity IEA --
GO:0019213 deacetylase activity IDA 21849506
genes like me logo Genes that share ontologies with OARD1: view
genes like me logo Genes that share phenotypes with OARD1: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for OARD1 Gene

Localization for OARD1 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for OARD1 gene
Compartment Confidence
nucleus 3
cytosol 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli (2)
  • Nucleus (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for OARD1 Gene

Pathways & Interactions for OARD1 Gene

SuperPathways for OARD1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for OARD1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0042278 purine nucleoside metabolic process IDA 21849506
genes like me logo Genes that share ontologies with OARD1: view

No data available for Pathways by source and SIGNOR curated interactions for OARD1 Gene

Drugs & Compounds for OARD1 Gene

No Compound Related Data Available

Transcripts for OARD1 Gene

Unigene Clusters for OARD1 Gene

O-acyl-ADP-ribose deacylase 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for OARD1 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b ^ 3a · 3b · 3c ^ 4a · 4b · 4c ^ 5 ^ 6 ^ 7a · 7b · 7c · 7d · 7e · 7f · 7g
SP1: - - - - -
SP2: - - - - - -
SP3: - - - -
SP4: - - - - - - -
SP5: - - - - - -
SP6: - - - - - - - -
SP7: - - - - - - -
SP8: - - -
SP9: - - -
SP10: - -
SP11: - -

Relevant External Links for OARD1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for OARD1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for OARD1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for OARD1 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (9.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for OARD1 Gene

Protein tissue co-expression partners for OARD1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of OARD1 Gene:


SOURCE GeneReport for Unigene cluster for OARD1 Gene:


Evidence on tissue expression from TISSUES for OARD1 Gene

  • Lung(4.3)
  • Pancreas(3.7)
  • Nervous system(2.2)
genes like me logo Genes that share expression patterns with OARD1: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for OARD1 Gene

Orthologs for OARD1 Gene

This gene was present in the common ancestor of animals.

Orthologs for OARD1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia OARD1 34
  • 100 (a)
C6H6orf130 33
  • 99.78 (n)
(Canis familiaris)
Mammalia OARD1 34
  • 97 (a)
C12H6orf130 33
  • 94.08 (n)
(Bos Taurus)
Mammalia OARD1 33 34
  • 91.45 (n)
(Mus musculus)
Mammalia Oard1 33 16 34
  • 91.23 (n)
(Monodelphis domestica)
Mammalia OARD1 34
  • 91 (a)
(Ornithorhynchus anatinus)
Mammalia OARD1 34
  • 85 (a)
(Gallus gallus)
Aves C26H6ORF130 33 34
  • 74.22 (n)
(Anolis carolinensis)
Reptilia OARD1 34
  • 70 (a)
(Danio rerio)
Actinopterygii oard1 33 34
  • 61.97 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.1173 33
fruit fly
(Drosophila melanogaster)
Insecta CG33054 33 34
  • 56.83 (n)
CG34261 34
  • 47 (a)
CG33056 34
  • 19 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP002604 33
  • 56.14 (n)
Species where no ortholog for OARD1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for OARD1 Gene

Gene Tree for OARD1 (if available)
Gene Tree for OARD1 (if available)

Paralogs for OARD1 Gene

(1) SIMAP similar genes for OARD1 Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with OARD1: view

No data available for Paralogs for OARD1 Gene

Variants for OARD1 Gene

Sequence variations from dbSNP and Humsavar for OARD1 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000653778 -- 41,070,328(-) A/C intron_variant
rs1000768007 -- 41,071,007(-) G/A intron_variant
rs1001038272 -- 41,072,411(-) C/T 5_prime_UTR_variant
rs1001551680 -- 41,072,990(-) GGCGGCGGCAGCGGCGGC/GGCGGC/GGCGGCGGCAGCGGCGGCGGCAGCGGCGGC upstream_transcript_variant
rs1002034823 -- 41,066,743(-) C/T downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for OARD1 Gene

Variant ID Type Subtype PubMed ID
nsv602970 CNV gain 21841781

Variation tolerance for OARD1 Gene

Residual Variation Intolerance Score: 73.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.77; 16.23% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for OARD1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OARD1 Gene

Disorders for OARD1 Gene

Additional Disease Information for OARD1

No disorders were found for OARD1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for OARD1 Gene

Publications for OARD1 Gene

  1. Orphan macrodomain protein (human C6orf130) is an O-acyl-ADP-ribose deacylase: solution structure and catalytic properties. (PMID: 21849506) Peterson FC … Volkman BF (The Journal of biological chemistry 2011) 2 3 4 58
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  3. The DNA sequence and analysis of human chromosome 6. (PMID: 14574404) Mungall AJ … Beck S (Nature 2003) 3 4 58
  4. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C … Emili A (Nature 2015) 3 58
  5. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein MY … Mann M (Cell 2015) 3 58

Products for OARD1 Gene

Sources for OARD1 Gene

Loading form....