Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NUS1 Gene

Aliases for NUS1 Gene

  • NUS1 Dehydrodolichyl Diphosphate Synthase Subunit 2 3
  • Nogo-B Receptor 2 3 4
  • Dehydrodolichyl Diphosphate Synthase Complex Subunit NUS1 3 4
  • Nuclear Undecaprenyl Pyrophosphate Synthase 1 Homolog 3 4
  • Cis-Prenyltransferase Subunit NgBR 3 4
  • C6orf68 3 4
  • NgBR 3 4
  • Nuclear Undecaprenyl Pyrophosphate Synthase 1 Homolog (S. Cerevisiae) 2
  • Dehydrodolichyl Diphosphate Syntase Complex Subunit NUS1 3
  • Transport And Golgi Organization 14 Homolog (Drosophila) 2
  • NUS1, Dehydrodolichyl Diphosphate Synthase Subunit 5
  • Transport And Golgi Organization 14 Homolog 3
  • Di-Trans,Poly-Cis-Decaprenylcistransferase 3
  • Chromosome 6 Open Reading Frame 68 2
  • EC 2.5.1.87 4
  • MGC:7199 3
  • TANGO14 3
  • CDG1AA 3
  • MRD55 3
  • NGBR 4

External Ids for NUS1 Gene

Previous HGNC Symbols for NUS1 Gene

  • C6orf68

Previous GeneCards Identifiers for NUS1 Gene

  • GC06P118104
  • GC06P117997
  • GC06P115577

Summaries for NUS1 Gene

Entrez Gene Summary for NUS1 Gene

  • This gene encodes a type I single transmembrane domain receptor, which is a subunit of cis-prenyltransferase, and serves as a specific receptor for the neural and cardiovascular regulator Nogo-B. The encoded protein is essential for dolichol synthesis and protein glycosylation. This gene is highly expressed in non-small cell lung carcinomas as well as estrogen receptor-alpha positive breast cancer cells where it promotes epithelial mesenchymal transition. This gene is associated with the poor prognosis of human hepatocellular carcinoma patients. Naturally occurring mutations in this gene cause a congenital disorder of glycosylation and are associated with epilepsy. A knockout of the orthologous gene in mice causes embryonic lethality before day 6.5. Pseudogenes of this gene have been defined on chromosomes 13 and X. [provided by RefSeq, May 2017]

GeneCards Summary for NUS1 Gene

NUS1 (NUS1 Dehydrodolichyl Diphosphate Synthase Subunit) is a Protein Coding gene. Diseases associated with NUS1 include Congenital Disorder Of Glycosylation, Type Iaa and Mental Retardation, Autosomal Dominant 55, With Seizures. Among its related pathways are Synthesis of substrates in N-glycan biosythesis and Transport to the Golgi and subsequent modification. Gene Ontology (GO) annotations related to this gene include transferase activity, transferring alkyl or aryl (other than methyl) groups.

UniProtKB/Swiss-Prot for NUS1 Gene

  • With DHDDS, forms the dehydrodolichyl diphosphate synthase (DDS) complex, an essential component of the dolichol monophosphate (Dol-P) biosynthetic machinery. Both subunits contribute to enzymatic activity, i.e. condensation of multiple copies of isopentenyl pyrophosphate (IPP) to farnesyl pyrophosphate (FPP) to produce dehydrodolichyl diphosphate (Dedol-PP), a precursor of dolichol phosphate which is utilized as a sugar carrier in protein glycosylation in the endoplasmic reticulum (ER) (PubMed:21572394, PubMed:25066056, PubMed:28842490). Regulates the glycosylation and stability of nascent NPC2, thereby promoting trafficking of LDL-derived cholesterol. Acts as a specific receptor for the N-terminus of Nogo-B, a neural and cardiovascular regulator (PubMed:16835300).

Additional gene information for NUS1 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NUS1 Gene

Genomics for NUS1 Gene

GeneHancer (GH) Regulatory Elements for NUS1 Gene

Promoters and enhancers for NUS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J117674 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 625.6 +0.8 780 4.9 SP1 CC2D1A CTCF ELF3 MNT MLLT1 ZNF121 RERE GTF2F1 ZNF384 NUS1 LOC101927919 GOPC PIR50962
GH06J118659 Enhancer 1.3 Ensembl ENCODE dbSUPER 18.4 +984.5 984490 1.9 HDGF NFIB ZSCAN21 YY1 ZNF174 PRDM1 MZF1 GMEB1 ZNF331 PKNOX1 NUS1 SSXP10 ASF1A MCM9 CEP85L
GH06J117599 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10.8 -73.8 -73841 5.2 SP1 CC2D1A ZFX ELF3 MNT NKRF POLR2A MLLT1 CEBPG RERE GOPC NEPNP DCBLD1 ENSG00000226181 NUS1 ROS1 GC06M117575
GH06J117439 Promoter/Enhancer 1.7 EPDnew ENCODE dbSUPER 9.7 -234.2 -234151 3 ZNF652 ELF3 CEBPG RERE ZSCAN21 ZNF24 MAFK TFE3 SP7 SP1 ROS1 DCBLD1 NUS1 RAP1BP3 ENSG00000226181 ENSG00000282218
GH06J117706 Enhancer 0.4 Ensembl 31.6 +31.7 31747 1.6 IKZF1 DPF2 NUS1 PIR50962
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around NUS1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the NUS1 gene promoter:
  • aMEF-2
  • AML1a
  • GATA-1
  • MEF-2
  • MEF-2A
  • Pax-5
  • STAT1
  • STAT1alpha
  • STAT1beta

Genomic Locations for NUS1 Gene

Genomic Locations for NUS1 Gene
chr6:117,675,454-117,710,727
(GRCh38/hg38)
Size:
35,274 bases
Orientation:
Plus strand
chr6:117,996,617-118,031,890
(GRCh37/hg19)
Size:
35,274 bases
Orientation:
Plus strand

Genomic View for NUS1 Gene

Genes around NUS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NUS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NUS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NUS1 Gene

Proteins for NUS1 Gene

  • Protein details for NUS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96E22-NGBR_HUMAN
    Recommended name:
    Dehydrodolichyl diphosphate synthase complex subunit NUS1
    Protein Accession:
    Q96E22
    Secondary Accessions:
    • B2RWQ4
    • O00251

    Protein attributes for NUS1 Gene

    Size:
    293 amino acids
    Molecular mass:
    33224 Da
    Cofactor:
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Forms an active dehydrodolichyl diphosphate synthase complex with DHDDS (PubMed:28842490, PubMed:19723497, PubMed:25066056). Interacts with NPC2 (PubMed:21572394).
    Miscellaneous:
    • NUS1 seems to exist in two topological orientations, a minor glycosylated species with its C-terminus oriented towards the lumen regulating NPC2 stability, and a major fraction oriented with its C-terminus directed towards the cytosol where it regulates cis-IPTase activity.
    SequenceCaution:
    • Sequence=AAB72234.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};

neXtProt entry for NUS1 Gene

Post-translational modifications for NUS1 Gene

  • Glycosylation at posLast=271271 and posLast=144144
  • Modification sites at PhosphoSitePlus

Other Protein References for NUS1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for NUS1 Gene

Domains & Families for NUS1 Gene

Gene Families for NUS1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted membrane proteins

Protein Domains for NUS1 Gene

Suggested Antigen Peptide Sequences for NUS1 Gene

GenScript: Design optimal peptide antigens:
  • Nuclear undecaprenyl pyrophosphate synthase 1 homolog (NGBR_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96E22

UniProtKB/Swiss-Prot:

NGBR_HUMAN :
  • Belongs to the UPP synthase family.
Family:
  • Belongs to the UPP synthase family.
genes like me logo Genes that share domains with NUS1: view

Function for NUS1 Gene

Molecular function for NUS1 Gene

UniProtKB/Swiss-Prot Function:
With DHDDS, forms the dehydrodolichyl diphosphate synthase (DDS) complex, an essential component of the dolichol monophosphate (Dol-P) biosynthetic machinery. Both subunits contribute to enzymatic activity, i.e. condensation of multiple copies of isopentenyl pyrophosphate (IPP) to farnesyl pyrophosphate (FPP) to produce dehydrodolichyl diphosphate (Dedol-PP), a precursor of dolichol phosphate which is utilized as a sugar carrier in protein glycosylation in the endoplasmic reticulum (ER) (PubMed:21572394, PubMed:25066056, PubMed:28842490). Regulates the glycosylation and stability of nascent NPC2, thereby promoting trafficking of LDL-derived cholesterol. Acts as a specific receptor for the N-terminus of Nogo-B, a neural and cardiovascular regulator (PubMed:16835300).
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(2E,6E)-farnesyl diphosphate + n isopentenyl diphosphate = di-trans,poly-cis-polyprenyl diphosphate + n diphosphate; Xref=Rhea:RHEA:53008, Rhea:RHEA-COMP:13431, ChEBI:CHEBI:33019, ChEBI:CHEBI:128769, ChEBI:CHEBI:136960, ChEBI:CHEBI:175763; EC=2.5.1.87; Evidence={ECO:0000269 PubMed:25066056, ECO:0000269 PubMed:28842490};.
UniProtKB/Swiss-Prot EnzymeRegulation:
Activated by phospholipids including cardiolipin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol and phosphatidylserine.
UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=11.1 uM for isopentenyl diphosphate {ECO:0000269 PubMed:28842490}; KM=0.68 uM for (2E,6E)-farnesyl diphosphate {ECO:0000269 PubMed:28842490}; Note=Values were measured with the heterodimer. kcat is 0.58 sec(-1) with (2E,6E)-farnesyl diphosphate and isopentenyl diphosphate as substrates. {ECO:0000269 PubMed:28842490}; pH dependence: Optimum pH is 8-9. Active from pH 5.5 to 9.3. {ECO:0000269 PubMed:28842490};

Enzyme Numbers (IUBMB) for NUS1 Gene

Phenotypes From GWAS Catalog for NUS1 Gene

Gene Ontology (GO) - Molecular Function for NUS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004659 contributes_to prenyltransferase activity IDA,IEA 25066056
GO:0005515 protein binding IPI 21572394
GO:0016740 transferase activity IEA --
GO:0016765 transferase activity, transferring alkyl or aryl (other than methyl) groups IEA --
GO:0045547 dehydrodolichyl diphosphate synthase activity IDA 28842490
genes like me logo Genes that share ontologies with NUS1: view
genes like me logo Genes that share phenotypes with NUS1: view

Human Phenotype Ontology for NUS1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for NUS1 Gene

MGI Knock Outs for NUS1:
  • Nus1 Nus1<tm1.1Wcsa>

Animal Model Products

  • Taconic Biosciences Mouse Models for NUS1

CRISPR Products

miRNA for NUS1 Gene

miRTarBase miRNAs that target NUS1

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NUS1

Clone Products

  • Applied Biological Materials (abm): Clones for NUS1 - Now 50% OFF >
  • * NUS1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * NUS1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Transcription Factor Targets and HOMER Transcription for NUS1 Gene

Localization for NUS1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for NUS1 Gene

Endoplasmic reticulum membrane; Multi-pass membrane protein. Note=Colocalizes with Nogo-B during VEGF and wound healing angiogenesis. {ECO:0000269 PubMed:19723497}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for NUS1 gene
Compartment Confidence
endoplasmic reticulum 5
plasma membrane 2
mitochondrion 2
cytosol 1
golgi apparatus 1
extracellular 0
cytoskeleton 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Plasma membrane (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for NUS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane IDA,TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:1904423 dehydrodolichyl diphosphate synthase complex IDA 28842490
genes like me logo Genes that share ontologies with NUS1: view

Pathways & Interactions for NUS1 Gene

genes like me logo Genes that share pathways with NUS1: view

UniProtKB/Swiss-Prot Q96E22-NGBR_HUMAN

  • Pathway: Protein modification; protein glycosylation.
  • Pathway: Lipid metabolism.

Gene Ontology (GO) - Biological Process for NUS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001525 angiogenesis IEA --
GO:0006486 protein glycosylation IEA --
GO:0006489 dolichyl diphosphate biosynthetic process TAS,IDA --
GO:0006629 lipid metabolic process IEA --
GO:0007275 multicellular organism development IEA --
genes like me logo Genes that share ontologies with NUS1: view

No data available for SIGNOR curated interactions for NUS1 Gene

Drugs & Compounds for NUS1 Gene

(1) Additional Compounds for NUS1 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Undecaprenyl diphosphate
  • Diphosphoric acid, mono(3,7,11,15,19,23,27,31,35,39,43-undecamethyl-2,6,10,14,18,22,26,30,34,38,42-tetratetracontaundecaenyl) ester
  • Undecaprenyl pyrophosphate
  • UndPP
  • Diphosphate, mono(3,7,11,15,19,23,27,31,35,39,43-undecamethyl-2,6,10,14,18,22,26,30,34,38,42-tetratetracontaundecaenyl) ester
  • Undecaprenyl diphosphoric acid
23-13-2
genes like me logo Genes that share compounds with NUS1: view

Transcripts for NUS1 Gene

mRNA/cDNA for NUS1 Gene

(1) REFSEQ mRNAs :
(12) Additional mRNA sequences :
(270) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Unigene Clusters for NUS1 Gene

Nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NUS1

Clone Products

  • Applied Biological Materials (abm): Clones for NUS1 - Now 50% OFF >
  • * NUS1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * NUS1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for NUS1 Gene

No ASD Table

Relevant External Links for NUS1 Gene

GeneLoc Exon Structure for
NUS1
ECgene alternative splicing isoforms for
NUS1

Expression for NUS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for NUS1 Gene

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for NUS1 Gene



Protein tissue co-expression partners for NUS1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of NUS1 Gene:

NUS1

SOURCE GeneReport for Unigene cluster for NUS1 Gene:

Hs.289008

Evidence on tissue expression from TISSUES for NUS1 Gene

  • Muscle(4.2)
  • Nervous system(2.8)
genes like me logo Genes that share expression patterns with NUS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for NUS1 Gene

Orthologs for NUS1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for NUS1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia NUS1 35 34
  • 99.43 (n)
OneToMany
-- 35
  • 99 (a)
OneToMany
dog
(Canis familiaris)
Mammalia NUS1 35 34
  • 94.2 (n)
OneToOne
cow
(Bos Taurus)
Mammalia NUS1 35 34
  • 94.08 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Nus1 17 35 34
  • 89.99 (n)
rat
(Rattus norvegicus)
Mammalia Nus1 34
  • 88.51 (n)
oppossum
(Monodelphis domestica)
Mammalia NUS1 35
  • 83 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia NUS1 35
  • 74 (a)
OneToOne
chicken
(Gallus gallus)
Aves NUS1 35 34
  • 75.55 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia NUS1 35
  • 63 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.11848 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.13098 34
zebrafish
(Danio rerio)
Actinopterygii nus1 35 34
  • 63.82 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000402 34
  • 46.15 (n)
fruit fly
(Drosophila melanogaster)
Insecta Tango14 35
  • 27 (a)
OneToOne
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes NUS1 37 35
  • 19 (a)
Species where no ortholog for NUS1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for NUS1 Gene

ENSEMBL:
Gene Tree for NUS1 (if available)
TreeFam:
Gene Tree for NUS1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for NUS1: view image

Paralogs for NUS1 Gene

Pseudogenes.org Pseudogenes for NUS1 Gene

genes like me logo Genes that share paralogs with NUS1: view

No data available for Paralogs for NUS1 Gene

Variants for NUS1 Gene

Sequence variations from dbSNP and Humsavar for NUS1 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1554200722 pathogenic, MENTAL RETARDATION, AUTOSOMAL DOMINANT 55, WITH SEIZURES 117,675,790(+) CTGCCGCGCCGCCTCTGCCGCG/CTGCCGCGCCGCCTCTGCCGCGCCGCCTCTGCCGCG coding_sequence_variant, frameshift
rs1554202698 pathogenic, MENTAL RETARDATION, AUTOSOMAL DOMINANT 55, WITH SEIZURES 117,703,656(+) A/ coding_sequence_variant, frameshift
rs1554202852 uncertain-significance, CONGENITAL DISORDER OF GLYCOSYLATION, TYPE Iaa 117,706,936(+) C/A coding_sequence_variant, missense_variant
rs886037858 pathogenic, CONGENITAL DISORDER OF GLYCOSYLATION, TYPE Iaa, Congenital disorder of glycosylation 1AA (CDG1AA) [MIM:617082] 117,707,002(+) G/A coding_sequence_variant, missense_variant
rs1000205837 -- 117,691,883(+) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for NUS1 Gene

Variant ID Type Subtype PubMed ID
nsv5449 CNV deletion 18451855
nsv830786 CNV gain 17160897
nsv969438 CNV duplication 23825009

Variation tolerance for NUS1 Gene

Residual Variation Intolerance Score: 71.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.04; 21.37% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for NUS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
NUS1
Human Gene Mutation Database (HGMD)
NUS1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for NUS1 Gene

Disorders for NUS1 Gene

MalaCards: The human disease database

(4) MalaCards diseases for NUS1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

UniProtKB/Swiss-Prot

NGBR_HUMAN
  • Congenital disorder of glycosylation 1AA (CDG1AA) [MIM:617082]: A form of congenital disorder of glycosylation, a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. CDG1AA inheritance is autosomal recessive. {ECO:0000269 PubMed:25066056}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Mental retardation, autosomal dominant 55, with seizures (MRD55) [MIM:617831]: A form of mental retardation, a disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. MRD55 patients suffer from seizures appearing during the first years of life. {ECO:0000269 PubMed:29100083}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for NUS1

genes like me logo Genes that share disorders with NUS1: view

No data available for Genatlas for NUS1 Gene

Publications for NUS1 Gene

  1. A conserved C-terminal RXG motif in the NgBR subunit of cis-prenyltransferase is critical for prenyltransferase activity. (PMID: 28842490) Grabińska KA … Sessa WC (The Journal of biological chemistry 2017) 2 3 4 58
  2. Mutation of Nogo-B receptor, a subunit of cis-prenyltransferase, causes a congenital disorder of glycosylation. (PMID: 25066056) Park EJ … Sessa WC (Cell metabolism 2014) 2 3 4 58
  3. Nogo-B receptor is necessary for cellular dolichol biosynthesis and protein N-glycosylation. (PMID: 21572394) Harrison KD … Sessa WC (The EMBO journal 2011) 3 4 58
  4. Nogo-B receptor stabilizes Niemann-Pick type C2 protein and regulates intracellular cholesterol trafficking. (PMID: 19723497) Harrison KD … Sessa WC (Cell metabolism 2009) 3 4 58
  5. Identification of a receptor necessary for Nogo-B stimulated chemotaxis and morphogenesis of endothelial cells. (PMID: 16835300) Miao RQ … Sessa WC (Proceedings of the National Academy of Sciences of the United States of America 2006) 3 4 58

Products for NUS1 Gene

Sources for NUS1 Gene

Content
Loading form....