Free for academic non-profit institutions. Other users need a Commercial license

NOTCH4 Gene(Protein Coding)

Notch 4

GCID:
GC06M032196
GIFtS:
55
Genes Participants
UDN Logo

Aliases for NOTCH4 Gene

Aliases for NOTCH4 Gene

  • Notch 4 2 3 4 5
  • INT3 3 4
  • Neurogenic Locus Notch Homolog Protein 4 3
  • Notch (Drosophila) Homolog 4 2
  • Notch Homolog 4 (Drosophila) 2
  • Notch Homolog 4 3
  • HNotch4 4

External Ids for NOTCH4 Gene

Previous HGNC Symbols for NOTCH4 Gene

  • INT3

Previous GeneCards Identifiers for NOTCH4 Gene

  • GC06M032185
  • GC06M031933
  • GC06M032234
  • GC06M032231
  • GC06M032270
  • GC06M032166

Summaries for NOTCH4 Gene

Entrez Gene Summary for NOTCH4 Gene

  • This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]

GeneCards Summary for NOTCH4 Gene

NOTCH4 (Notch 4) is a Protein Coding gene. Diseases associated with NOTCH4 include Cerebral Degeneration and Cerebral Arteriopathy, Autosomal Dominant, With Subcortical Infarcts And Leukoencephalopathy, Type 1. Among its related pathways are PAK Pathway and Thyroid hormone signaling pathway. Gene Ontology (GO) annotations related to this gene include calcium ion binding and receptor activity. An important paralog of this gene is NOTCH1.

UniProtKB/Swiss-Prot for NOTCH4 Gene

  • Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. May regulate branching morphogenesis in the developing vascular system (By similarity).

Gene Wiki entry for NOTCH4 Gene

Additional gene information for NOTCH4 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NOTCH4 Gene

Genomics for NOTCH4 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for NOTCH4 Gene

Promoters and enhancers for NOTCH4 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH06I032224 Enhancer 0.6 ENCODE 550.8 -0.8 -812 0.2 NR2F1 JUNB EBF1 DPF2 BATF IRF4 BCL11A TARDBP IKZF1 BCLAF1 NOTCH4 ENSG00000277427
GH06I032222 Enhancer 0.5 Ensembl 578.6 +1.0 966 0.6 ZFHX2 RXRA IKZF1 ZNF398 NR2F2 SPI1 NOTCH4 HLA-DRB6 BAG6 GC06M032214
GH06I032225 Promoter 0.5 EPDnew 550.8 0.0 -20 0.1 NOTCH4 ENSG00000277427
GH06I032185 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 16.1 +32.8 32787 13.4 CLOCK MLX YBX1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 PBX2 GPSM3 ATF6B DDX39B BRD2 LSM2 LY6G5B HLA-DRB1 MSH5 MICA
GH06I031493 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 8.8 +727.8 727784 5.8 PKNOX1 ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B POLR2B ZNF213 MICB ENSG00000201680 GC06M031496 MICB-DT DDX39B ATF6B ATP6V1G2 LSM2 PPP1R10 PSORS1C2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around NOTCH4 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the NOTCH4 gene promoter:

Genomic Locations for NOTCH4 Gene

Genomic Locations for NOTCH4 Gene
chr6:32,194,843-32,224,067
(GRCh38/hg38)
Size:
29,225 bases
Orientation:
Minus strand
chr6:32,162,620-32,191,844
(GRCh37/hg19)

Genomic View for NOTCH4 Gene

Genes around NOTCH4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NOTCH4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NOTCH4 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for NOTCH4 Gene

Proteins for NOTCH4 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for NOTCH4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q99466-NOTC4_HUMAN
    Recommended name:
    Neurogenic locus notch homolog protein 4
    Protein Accession:
    Q99466
    Secondary Accessions:
    • B0V183
    • B0V1X5
    • O00306
    • Q5SSY7
    • Q99458
    • Q99940
    • Q9H3S8
    • Q9UII9
    • Q9UIJ0

    Protein attributes for NOTCH4 Gene

    Size:
    2003 amino acids
    Molecular mass:
    209622 Da
    Quaternary structure:
    • Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH4.
    SequenceCaution:
    • Sequence=BAA09708.1; Type=Frameshift; Positions=1438, 1463; Evidence={ECO:0000305};

    Alternative splice isoforms for NOTCH4 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for NOTCH4 Gene

Protein Expression for NOTCH4 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for NOTCH4 Gene

  • Phosphorylated.
  • Synthesized in the endoplasmic reticulum as an inactive form which is proteolytically cleaved by a furin-like convertase in the trans-Golgi network before it reaches the plasma membrane to yield an active, ligand-accessible form. Cleavage results in a C-terminal fragment N(TM) and a N-terminal fragment N(EC). Following ligand binding, it is cleaved by TNF-alpha converting enzyme (TACE) to yield a membrane-associated intermediate fragment called notch extracellular truncation (NEXT). This fragment is then cleaved by presenilin dependent gamma-secretase to release a notch-derived peptide containing the intracellular domain (NICD) from the membrane (By similarity).
  • Glycosylation at Asn664, Asn714, isoforms=964, and isoforms=1143

Other Protein References for NOTCH4 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for NOTCH4 (NOTCH4)
  • Abcam antibodies for NOTCH4
  • Cloud-Clone Corp. Antibodies for NOTCH4

No data available for DME Specific Peptides for NOTCH4 Gene

Domains & Families for NOTCH4 Gene

Gene Families for NOTCH4 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted membrane proteins

Protein Domains for NOTCH4 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for NOTCH4 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q99466

UniProtKB/Swiss-Prot:

NOTC4_HUMAN :
  • Belongs to the NOTCH family.
Family:
  • Belongs to the NOTCH family.
genes like me logo Genes that share domains with NOTCH4: view

Function for NOTCH4 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for NOTCH4 Gene

GENATLAS Biochemistry:
Drosophila Notch homolog 4,mediating cell-cell interactions that specify cell fate during development,undergoing a first proteolytic cleavage by furin (PACE1) in the Golgi during trafficking of Notch to the cell surface,undergoing further cleavage by gamma secretase (see PSEN1) releasing an intracellular domain (NICD) which translocates to the nucleus and modulates transcription of target genes,homologous to MMTV integration site int-3,containing a (CTG)n repeats polymorphism,with 2 isoforms L and S
UniProtKB/Swiss-Prot Function:
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. May regulate branching morphogenesis in the developing vascular system (By similarity).

Phenotypes From GWAS Catalog for NOTCH4 Gene

Gene Ontology (GO) - Molecular Function for NOTCH4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004872 receptor activity TAS 11823422
GO:0005509 calcium ion binding TAS 11823422
GO:0005515 protein binding IPI 7671825
GO:0046872 metal ion binding IEA --
GO:0046982 protein heterodimerization activity TAS 8681805
genes like me logo Genes that share ontologies with NOTCH4: view
genes like me logo Genes that share phenotypes with NOTCH4: view

Animal Models for NOTCH4 Gene

MGI Knock Outs for NOTCH4:

Animal Model Products

miRNA for NOTCH4 Gene

miRTarBase miRNAs that target NOTCH4

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for NOTCH4 Gene

Localization for NOTCH4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for NOTCH4 Gene

Cell membrane; Single-pass type I membrane protein.
Notch 4 intracellular domain: Nucleus. Note=Following proteolytical processing NICD is translocated to the nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for NOTCH4 gene
Compartment Confidence
plasma membrane 5
extracellular 5
nucleus 5
endoplasmic reticulum 5
cytosol 4
golgi apparatus 4
cytoskeleton 1
mitochondrion 1
lysosome 1

Gene Ontology (GO) - Cellular Components for NOTCH4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane TAS --
GO:0005576 extracellular region TAS --
GO:0005634 nucleus TAS 8681805
GO:0005654 nucleoplasm TAS --
GO:0005789 endoplasmic reticulum membrane TAS --
genes like me logo Genes that share ontologies with NOTCH4: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for NOTCH4 Gene

Pathways & Interactions for NOTCH4 Gene

genes like me logo Genes that share pathways with NOTCH4: view

SIGNOR curated interactions for NOTCH4 Gene

Activates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for NOTCH4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001569 branching involved in blood vessel morphogenesis ISS --
GO:0001709 cell fate determination TAS 11823422
GO:0001763 morphogenesis of a branching structure ISS --
GO:0001886 endothelial cell morphogenesis IEA --
GO:0006351 transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with NOTCH4: view

Drugs & Compounds for NOTCH4 Gene

Products:

  1. Drug

(9) Drugs for NOTCH4 Gene - From: ApexBio and DGIdb

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
PF-03084014 Pharma other γ-secretase inhibitor, Other 0
BMS-983970 Pharma 0
FLI-06 Pharma 0
LY3039478 Pharma Notch inhibitor, novel and potent 0
LY-900009 Pharma Potent Notch inhibitor 0

(2) Additional Compounds for NOTCH4 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs

(6) ApexBio Compounds for NOTCH4 Gene

Compound Action Cas Number
BMS-983970 1584713-87-0
FLI-06 313967-18-9
LY3039478 Notch inhibitor, novel and potent 1421438-81-4
LY-900009 Potent Notch inhibitor 209984-68-9
PF-03084014 γ-secretase inhibitor 865773-15-5
Z-Ile-Leu-aldehyde 161710-10-7
genes like me logo Genes that share compounds with NOTCH4: view

Drug Products

Transcripts for NOTCH4 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for NOTCH4 Gene

(1) REFSEQ mRNAs :
(11) Additional mRNA sequences :
(222) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for NOTCH4 Gene

Notch 4:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for NOTCH4 Gene

No ASD Table

Relevant External Links for NOTCH4 Gene

GeneLoc Exon Structure for
NOTCH4
ECgene alternative splicing isoforms for
NOTCH4

Expression for NOTCH4 Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for NOTCH4 Gene

mRNA expression in normal human tissues for NOTCH4 Gene
mRNA expression by GTEx for NOTCH4 GenemRNA expression by BioGPS for NOTCH4 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for NOTCH4 Gene

This gene is overexpressed in Adipose - Visceral (Omentum) (x4.6).

Protein differential expression in normal tissues from HIPED for NOTCH4 Gene

This gene is overexpressed in Adipocyte (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for NOTCH4 Gene



Protein tissue co-expression partners for NOTCH4 Gene

NURSA nuclear receptor signaling pathways regulating expression of NOTCH4 Gene:

NOTCH4

SOURCE GeneReport for Unigene cluster for NOTCH4 Gene:

Hs.436100

mRNA Expression by UniProt/SwissProt for NOTCH4 Gene:

Q99466-NOTC4_HUMAN
Tissue specificity: Highly expressed in the heart, moderately in the lung and placenta and at low levels in the liver, skeletal muscle, kidney, pancreas, spleen, lymph node, thymus, bone marrow and fetal liver. No expression was seen in adult brain or peripheral blood leukocytes.

Evidence on tissue expression from TISSUES for NOTCH4 Gene

  • Heart(4.4)
  • Bone marrow(4.3)
  • Nervous system(3.3)
  • Blood(2.6)
  • Muscle(2.5)
  • Skin(2)
genes like me logo Genes that share expression patterns with NOTCH4: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for NOTCH4 Gene

Orthologs for NOTCH4 Gene

This gene was present in the common ancestor of animals.

Orthologs for NOTCH4 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia NOTCH4 34 33
  • 99.42 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia NOTCH4 34 33
  • 87.09 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia NOTCH4 34 33
  • 86.89 (n)
 OneToOne
mouse
(Mus musculus)
 Mammalia Notch4 34 16 33
  • 83.21 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Notch4 33
  • 82.37 (n)
oppossum
(Monodelphis domestica)
 Mammalia NOTCH4 34
  • 71 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia -- 34
  • 27 (a)
 ManyToMany
lizard
(Anolis carolinensis)
 Reptilia NOTCH4 34
  • 38 (a)
 OneToOne
fruit fly
(Drosophila melanogaster)
 Insecta CG15388 35
  • 39 (a)
SP1070 35
  • 37 (a)
N 34
  • 28 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea W02C12.1 35
  • 33 (a)
Y69H2.12 35
  • 29 (a)
R05G6.9 35
  • 28 (a)
F55G1.13 35
  • 27 (a)
Y69H2.11 35
  • 26 (a)
sea squirt
(Ciona savignyi)
 Ascidiacea -- 34
  • 33 (a)
 ManyToMany
-- 34
  • 30 (a)
 ManyToMany
-- 34
  • 30 (a)
 ManyToMany
CSA.3605 34
  • 27 (a)
 ManyToMany
CSA.131 34
  • 26 (a)
 ManyToMany
Species where no ortholog for NOTCH4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for NOTCH4 Gene

ENSEMBL:
Gene Tree for NOTCH4 (if available)
TreeFam:
Gene Tree for NOTCH4 (if available)

Paralogs for NOTCH4 Gene

Paralogs for NOTCH4 Gene

(7) SIMAP similar genes for NOTCH4 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with NOTCH4: view

Variants for NOTCH4 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for NOTCH4 Gene

NOTC4_HUMAN-Q99466
The poly-Leu region of NOTCH4 (in the signal peptide) is polymorphic and the number of Leu varies in the population (from 6 to 12).

Sequence variations from dbSNP and Humsavar for NOTCH4 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs150079294 likely-benign, Anophthalmia - microphthalmia 32,212,907(-) A/C coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs148746475 uncertain-significance, not specified 32,197,424(-) G/A coding_sequence_variant, non_coding_transcript_variant, stop_gained
rs9281675 benign, not specified 32,223,882(-) AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG coding_sequence_variant, inframe_deletion, inframe_insertion, non_coding_transcript_variant
rs1000189312 -- 32,220,197(-) G/A coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs1000276522 -- 32,198,843(-) T/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for NOTCH4 Gene

Variant ID Type Subtype PubMed ID
nsv830629 CNV loss 17160897
nsv602105 CNV loss 21841781
nsv602104 CNV loss 21841781
nsv462877 CNV loss 19166990
nsv1126749 CNV deletion 24896259
nsv1112900 CNV deletion 24896259
nsv10826 CNV loss 18304495
nsv1073969 CNV deletion 25765185
esv3608578 CNV loss 21293372
esv2759415 CNV gain+loss 17122850
esv2677748 CNV deletion 23128226
dgv10472n54 CNV loss 21841781
dgv10463n54 CNV loss 21841781
dgv10404n54 CNV loss 21841781

Variation tolerance for NOTCH4 Gene

Residual Variation Intolerance Score: 62.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 14.38; 96.35% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for NOTCH4 Gene

Human Gene Mutation Database (HGMD)
NOTCH4
SNPedia medical, phenotypic, and genealogical associations of SNPs for
NOTCH4

Disorders for NOTCH4 Gene

MalaCards: The human disease database

(11) MalaCards diseases for NOTCH4 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for NOTCH4

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
Tumor Gene Database
(TGDB)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with NOTCH4: view

No data available for UniProtKB/Swiss-Prot and Genatlas for NOTCH4 Gene

Publications for NOTCH4 Gene

  1. Several loci in the HLA class III region are associated with T1D risk after adjusting for DRB1-DQB1. (PMID: 19143814) Valdes AM … Type 1 Diabetes Genetics Consortium (Diabetes, obesity & metabolism 2009) 3 22 44 58
  2. Genetic association between Notch4 polymorphisms and Alzheimer's disease in the Japanese population. (PMID: 17452726) Shibata N … Arai H (The journals of gerontology. Series A, Biological sciences and medical sciences 2007) 3 22 44 58
  3. Association study between the TNXB locus and schizophrenia in a Japanese population. (PMID: 17192952) Tochigi M … Sasaki T (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2007) 3 22 44 58
  4. Association evidence of schizophrenia with distal genomic region of NOTCH4 in Taiwanese families. (PMID: 17054719) Liu CM … Hwu HG (Genes, brain, and behavior 2007) 3 22 44 58
  5. No evidence for association between NOTCH4 and schizophrenia in a large family-based and case-control association analysis. (PMID: 16969274) Ivo R … Cichon S (Psychiatric genetics 2006) 3 22 44 58

Products for NOTCH4 Gene

Sources for NOTCH4 Gene

Content
Loading form....