Aliases for NOTCH4 Gene
Aliases for NOTCH4 Gene
External Ids for NOTCH4 Gene
- HGNC: 7884
- Entrez Gene: 4855
- Ensembl: ENSG00000204301
- OMIM: 164951
- UniProtKB: Q99466
Previous HGNC Symbols for NOTCH4 Gene
- INT3
Previous GeneCards Identifiers for NOTCH4 Gene
- GC06M032185
- GC06M031933
- GC06M032234
- GC06M032231
- GC06M032270
- GC06M032166
Summaries for NOTCH4 Gene
-
This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
GeneCards Summary for NOTCH4 Gene
NOTCH4 (Notch 4) is a Protein Coding gene. Diseases associated with NOTCH4 include Cerebral Degeneration and Cerebral Arteriopathy, Autosomal Dominant, With Subcortical Infarcts And Leukoencephalopathy, Type 1. Among its related pathways are Gene Expression and Notch signaling pathway (KEGG). Gene Ontology (GO) annotations related to this gene include calcium ion binding. An important paralog of this gene is NOTCH1.
UniProtKB/Swiss-Prot for NOTCH4 Gene
-
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. May regulate branching morphogenesis in the developing vascular system (By similarity).
Additional gene information for NOTCH4 Gene
- Monarch Initiative
- Search for NOTCH4 at DataMed
- Search for NOTCH4 at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NOTCH4 Gene
Genomics for NOTCH4 Gene
GeneHancer (GH) Regulatory Elements for NOTCH4 Gene
Promoters and enhancers for NOTCH4 Gene
| GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
|---|---|---|---|---|---|---|---|---|---|---|
| GH06J032184 | Promoter/Enhancer | 2.5 | EPDnew Ensembl ENCODE dbSUPER | 666.1 | +32.8 | 32787 | 13.4 | CLOCK MLX YBX1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 | PBX2 NOTCH4 GPSM3 ATF6B BRD2 DDX39B LY6G5B LSM2 RPL3P2 SKIV2L | |
| GH06J032224 | Enhancer | 0.6 | ENCODE | 650.7 | -0.8 | -812 | 0.2 | NR2F1 JUNB EBF1 DPF2 BATF IRF4 BCL11A TARDBP IKZF1 EED | NOTCH4 HCG23 | |
| GH06J032222 | Enhancer | 0.5 | Ensembl | 678.5 | +1.0 | 966 | 0.6 | ZFHX2 RXRA IKZF1 ZNF398 NR2F2 SPI1 | NOTCH4 HLA-DRB6 BAG6 GC06M032214 | |
| GH06J032225 | Promoter | 0.5 | EPDnew | 650.7 | 0.0 | -20 | 0.1 | NOTCH4 HCG23 | ||
| GH06J031493 | Promoter/Enhancer | 2.1 | EPDnew Ensembl ENCODE | 8.8 | +727.8 | 727784 | 5.8 | PKNOX1 ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B POLR2B ZNF213 | MICB MICB-DT GC06M031496 ENSG00000201680 DDX39B ATF6B ATP6V1G2 LSM2 PPP1R10 PSORS1C2 |
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around NOTCH4 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the NOTCH4 gene promoter:
-
- p53
- PPAR-alpha
- HEN1
- ATF6
- NF-kappaB1
- MyoD
- ITF-2
- Tal-1beta
- Ik-2
Regulatory Element Products
Genomic Locations for NOTCH4 Gene
Genomic Locations for NOTCH4 Gene
- chr6:32,194,843-32,224,067
- (GRCh38/hg38)
- Size:
- 29,225 bases
- Orientation:
- Minus strand
- chr6:32,162,620-32,191,844
- (GRCh37/hg19)
- Size:
- 29,225 bases
- Orientation:
- Minus strand
Genomic View for NOTCH4 Gene
Genes around NOTCH4 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 6p21.32 by Entrez Gene
- 6p21.32 by HGNC
- 6p21.32 by Ensembl
NOTCH4 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for NOTCH4 Gene
Proteins for NOTCH4 Gene
-
Protein details for NOTCH4 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q99466-NOTC4_HUMAN
- Recommended name:
- Neurogenic locus notch homolog protein 4
- Protein Accession:
- Q99466
- B0V183
- B0V1X5
- O00306
- Q5SSY7
- Q99458
- Q99940
- Q9H3S8
- Q9UII9
- Q9UIJ0
Protein attributes for NOTCH4 Gene
- Size:
- 2003 amino acids
- Molecular mass:
- 209622 Da
- Quaternary structure:
-
- Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH4.
- SequenceCaution:
-
- Sequence=BAA09708.1; Type=Frameshift; Positions=1438, 1463; Evidence={ECO:0000305};
Protein Expression for NOTCH4 Gene
Post-translational modifications for NOTCH4 Gene
- Synthesized in the endoplasmic reticulum as an inactive form which is proteolytically cleaved by a furin-like convertase in the trans-Golgi network before it reaches the plasma membrane to yield an active, ligand-accessible form. Cleavage results in a C-terminal fragment N(TM) and a N-terminal fragment N(EC). Following ligand binding, it is cleaved by TNF-alpha converting enzyme (TACE) to yield a membrane-associated intermediate fragment called notch extracellular truncation (NEXT). This fragment is then cleaved by presenilin dependent gamma-secretase to release a notch-derived peptide containing the intracellular domain (NICD) from the membrane (By similarity).
- Phosphorylated.
- Glycosylation at isoforms=1143, Asn964, Asn714, and Asn664
- Modification sites at PhosphoSitePlus
Other Protein References for NOTCH4 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for NOTCH4 (Notch-4)
- Novus Biologicals Antibodies for NOTCH4
-
Abcam antibodies for NOTCH4
- Invitrogen Antibodies for NOTCH4
- GeneTex Notch4 Antibody for NOTCH4
-
Santa Cruz Biotechnology (SCBT) Antibodies for NOTCH4
Protein Products
- R&D Systems Proteins and Enzymes for NOTCH4 (Notch-4)
-
OriGene Purified Proteins for NOTCH4
- Search Origene for MassSpec and Protein Over-expression Lysates for NOTCH4
- Origene Custom Protein Services for NOTCH4
- Novus Biologicals lysates for NOTCH4
- Sino Biological Recombinant Proteins for NOTCH4
- Sino Biological Cell Lysates for NOTCH4
- Search GeneTex for Proteins for NOTCH4
Assay Products
No data available for DME Specific Peptides for NOTCH4 Gene
Domains & Families for NOTCH4 Gene
Gene Families for NOTCH4 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted membrane proteins
Protein Domains for NOTCH4 Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for NOTCH4 Gene
Graphical View of Domain Structure for InterPro Entry
Q99466- Family:
-
- Belongs to the NOTCH family.
Function for NOTCH4 Gene
Molecular function for NOTCH4 Gene
- UniProtKB/Swiss-Prot Function:
- Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. May regulate branching morphogenesis in the developing vascular system (By similarity).
- GENATLAS Biochemistry:
- Drosophila Notch homolog 4,mediating cell-cell interactions that specify cell fate during development,undergoing a first proteolytic cleavage by furin (PACE1) in the Golgi during trafficking of Notch to the cell surface,undergoing further cleavage by gamma secretase (see PSEN1) releasing an intracellular domain (NICD) which translocates to the nucleus and modulates transcription of target genes,homologous to MMTV integration site int-3,containing a (CTG)n repeats polymorphism,with 2 isoforms L and S
Phenotypes From GWAS Catalog for NOTCH4 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005509 | calcium ion binding | TAS | 11823422 |
| GO:0005515 | protein binding | IPI | 7671825 |
| GO:0038023 | signaling receptor activity | TAS | 11823422 |
| GO:0046872 | metal ion binding | IEA | -- |
| GO:0046982 | protein heterodimerization activity | TAS | 8681805 |
Phenotypes for NOTCH4 Gene
- MGI mutant phenotypes for NOTCH4:
- inferred from 4 alleles
- GenomeRNAi human phenotypes for NOTCH4:
Animal Models for NOTCH4 Gene
Animal Model Products
-
Taconic Biosciences Mouse Models for NOTCH4
- Cyagen custom Knockout/knockin (KOKI) mouse models for NOTCH4
-
CRISPR Products
-
OriGene CRISPR knockouts for NOTCH4
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for NOTCH4
- genomics-online: gRNA clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- Applied Biological Materials CRISPR for NOTCH4
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for NOTCH4
- GenScript: Design CRISPR guide RNA sequences for NOTCH4
miRNA for NOTCH4 Gene
- miRTarBase miRNAs that target NOTCH4
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for NOTCH4
- Browse OriGene Inhibitory RNA Products For NOTCH4
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NOTCH4
- genomics-online: shRNA clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
Clone Products
-
OriGene ORF clones in human for NOTCH4
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for NOTCH4
- VectorBuilder custom plasmid, inducible vectors for NOTCH4
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for NOTCH4
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for NOTCH4
- Applied Biological Materials Clones for NOTCH4
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for NOTCH4 (Notch-4)
Cell Line Products
-
Horizon Cell Lines for NOTCH4
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for NOTCH4 Gene
Localization for NOTCH4 Gene
Subcellular locations from UniProtKB/Swiss-Prot for NOTCH4 Gene
- Cell membrane; Single-pass type I membrane protein.
- Notch 4 intracellular domain: Nucleus. Note=Following proteolytical processing NICD is translocated to the nucleus.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| extracellular | 5 |
| nucleus | 5 |
| endoplasmic reticulum | 5 |
| cytosol | 4 |
| golgi apparatus | 4 |
| cytoskeleton | 1 |
| mitochondrion | 1 |
| lysosome | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000139 | Golgi membrane | TAS | -- |
| GO:0005576 | extracellular region | TAS | -- |
| GO:0005634 | nucleus | TAS | 8681805 |
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0005789 | endoplasmic reticulum membrane | TAS | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for NOTCH4 Gene
Pathways & Interactions for NOTCH4 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Notch signaling pathway (KEGG) |
.30
|
|
| 2 | Pre-NOTCH Expression and Processing | ||
| 3 | Diseases of glycosylation | ||
| 4 | Gene Expression |
.48
|
|
| 5 | Signaling by NOTCH1 | ||
Pathways by source for NOTCH4 Gene
1 Sino Biological pathway for NOTCH4 Gene
2 GeneTex pathways for NOTCH4 Gene
5 BioSystems pathways for NOTCH4 Gene
14 Reactome pathways for NOTCH4 Gene
7 KEGG pathways for NOTCH4 Gene
2 R&D Systems pathways for NOTCH4 Gene
4 Qiagen pathways for NOTCH4 Gene
3 Cell Signaling Technology pathways for NOTCH4 Gene
Interacting Proteins for NOTCH4 Gene
GPS-Prot Interaction Network for NOTCH4
SIGNOR curated interactions for NOTCH4 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001569 | branching involved in blood vessel morphogenesis | ISS | -- |
| GO:0001709 | cell fate determination | TAS | 11823422 |
| GO:0001763 | morphogenesis of a branching structure | ISS | -- |
| GO:0001886 | endothelial cell morphogenesis | IEA | -- |
| GO:0001944 | vasculature development | ISS | -- |
Drugs & Compounds for NOTCH4 Gene
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Drug Products
Transcripts for NOTCH4 Gene
mRNA/cDNA for NOTCH4 Gene
- (1) REFSEQ mRNAs :
- (11) Additional mRNA sequences :
- (222) Selected AceView cDNA sequences:
- (5) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000491215 1632 bps (uc063nqj.1)
- ENST00000474612 5267 bps (uc063nqk.1)
- ENST00000375023 6745 bps (uc003obb.3)
- ENST00000465528 564 bps (uc063nql.1)
- ENST00000473562 3075 bps (uc063nqm.1)
CRISPR Products
-
OriGene CRISPR knockouts for NOTCH4
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for NOTCH4
- genomics-online: gRNA clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- Applied Biological Materials CRISPR for NOTCH4
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for NOTCH4
- GenScript: Design CRISPR guide RNA sequences for NOTCH4
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for NOTCH4
- Browse OriGene Inhibitory RNA Products For NOTCH4
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NOTCH4
- genomics-online: shRNA clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
Clone Products
-
OriGene ORF clones in human for NOTCH4
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for NOTCH4
- VectorBuilder custom plasmid, inducible vectors for NOTCH4
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for NOTCH4
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for NOTCH4
- Applied Biological Materials Clones for NOTCH4
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for NOTCH4 (Notch-4)
Expression for NOTCH4 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Lateral Plate Mesoderm (Gastrulation Derivatives)
- Angioblasts Embryonic Capillary Plexus
- Angioblasts Embryonic Blood Islands
- Angioblasts Proepicardium
-
Endothelium (Cardiovascular System)
- Angioblasts Embryonic Capillary Plexus
- Angioblasts Embryonic Blood Islands
- Angioblasts Proepicardium
-
Blood (Hematopoietic System)
- Granulocytes Peripheral Blood
- Conventional Dendritic Cells I Spleen
- Skeletal Muscle (Muscoskeletal System)
-
Placenta (Extraembryonic Tissues)
- Extravillous Cytotrophoblast Cells Extravillous Cytotrophoblast Layer
- Spleen (Hematopoietic System)
mRNA differential expression in normal tissues according to GTEx for NOTCH4 Gene
This gene is overexpressed in Adipose - Visceral (Omentum) (x4.6).
This gene is overexpressed in Adipocyte (69.0).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for NOTCH4 Gene
NURSA nuclear receptor signaling pathways regulating expression of NOTCH4 Gene:
NOTCH4SOURCE GeneReport for Unigene cluster for NOTCH4 Gene:
Hs.436100mRNA Expression by UniProt/SwissProt for NOTCH4 Gene:
Q99466-NOTC4_HUMAN
Tissue specificity:
Highly expressed in the heart, moderately in the lung and placenta and at low levels in the liver, skeletal muscle, kidney, pancreas, spleen, lymph node, thymus, bone marrow and fetal liver. No expression was seen in adult brain or peripheral blood leukocytes.
Evidence on tissue expression from TISSUES for NOTCH4 Gene
- Heart(4.4)
- Bone marrow(4.3)
- Nervous system(3.3)
- Blood(2.6)
- Muscle(2.6)
- Skin(2)
Primer Products
-
OriGene qPCR primer pairs for NOTCH4
- genomics-online: primer clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
Gene Expression Assay Products
No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for NOTCH4 Gene
Orthologs for NOTCH4 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | NOTCH4 34 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | NOTCH4 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | NOTCH4 34 33 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Notch4 16 34 33 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Notch4 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | NOTCH4 34 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 34 |
|
ManyToMany | |
| lizard (Anolis carolinensis) |
Reptilia | NOTCH4 34 |
|
OneToOne | |
| fruit fly (Drosophila melanogaster) |
Insecta | CG15388 35 |
|
|
|
| SP1070 35 |
|
|
|||
| N 34 |
|
OneToMany | |||
| worm (Caenorhabditis elegans) |
Secernentea | W02C12.1 35 |
|
|
|
| Y69H2.12 35 |
|
|
|||
| R05G6.9 35 |
|
|
|||
| F55G1.13 35 |
|
|
|||
| Y69H2.11 35 |
|
|
|||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
ManyToMany | |
| -- 34 |
|
ManyToMany | |||
| -- 34 |
|
ManyToMany | |||
| CSA.3605 34 |
|
ManyToMany | |||
| CSA.131 34 |
|
ManyToMany |
- Species where no ortholog for NOTCH4 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- tropical clawed frog (Silurana tropicalis)
- wheat (Triticum aestivum)
- zebrafish (Danio rerio)
Evolution for NOTCH4 Gene
- ENSEMBL:
- Gene Tree for NOTCH4 (if available)
- TreeFam:
- Gene Tree for NOTCH4 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for NOTCH4: view image
Paralogs for NOTCH4 Gene
(7) SIMAP similar genes for NOTCH4 Gene using alignment to 4 proteins:
- NOTC4_HUMAN
- B2RTR4_HUMAN
- B4DFM3_HUMAN
- Q6P3V5_HUMAN
Variants for NOTCH4 Gene
Polymorphic Variants from UniProtKB/Swiss-Prot for NOTCH4 Gene
- NOTC4_HUMAN-Q99466
- The poly-Leu region of NOTCH4 (in the signal peptide) is polymorphic and the number of Leu varies in the population (from 6 to 12).
| SNP ID | Clin | Chr 06 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs150079294 | likely-benign, Anophthalmia - microphthalmia | 32,212,907(-) | A/C | coding_sequence_variant, missense_variant, non_coding_transcript_variant | |
| rs148746475 | uncertain-significance, not specified | 32,197,424(-) | G/A | coding_sequence_variant, non_coding_transcript_variant, stop_gained | |
| rs9281675 | benign, not specified | 32,223,882(-) | AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | coding_sequence_variant, inframe_deletion, inframe_insertion, non_coding_transcript_variant | |
| rs1000189312 | -- | 32,220,197(-) | G/A | coding_sequence_variant, missense_variant, non_coding_transcript_variant | |
| rs1000276522 | -- | 32,198,843(-) | T/C | intron_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| dgv10404n54 | CNV | loss | 21841781 |
| dgv10463n54 | CNV | loss | 21841781 |
| dgv10472n54 | CNV | loss | 21841781 |
| esv2677748 | CNV | deletion | 23128226 |
| esv2759415 | CNV | gain+loss | 17122850 |
| esv3608578 | CNV | loss | 21293372 |
| nsv1073969 | CNV | deletion | 25765185 |
| nsv10826 | CNV | loss | 18304495 |
| nsv1112900 | CNV | deletion | 24896259 |
| nsv1126749 | CNV | deletion | 24896259 |
| nsv462877 | CNV | loss | 19166990 |
| nsv602104 | CNV | loss | 21841781 |
| nsv602105 | CNV | loss | 21841781 |
| nsv830629 | CNV | loss | 17160897 |
Residual Variation Intolerance Score:
62.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
14.38;
96.35% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for NOTCH4 Gene
SNP Genotyping and Copy Number Assay Products
Disorders for NOTCH4 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| cerebral degeneration |
|
|
| cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1 |
|
|
| pseudobulbar palsy |
|
|
| schizoaffective disorder |
|
|
| atypical choroid plexus papilloma |
|
|
Search NOTCH4 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for NOTCH4
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- Tumor Gene Database
- (TGDB)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for NOTCH4 Gene
Publications for NOTCH4 Gene
- Several loci in the HLA class III region are associated with T1D risk after adjusting for DRB1-DQB1. (PMID: 19143814) Valdes AM … Type 1 Diabetes Genetics Consortium (Diabetes, obesity & metabolism 2009) 3 22 44 58
- Association evidence of schizophrenia with distal genomic region of NOTCH4 in Taiwanese families. (PMID: 17054719) Liu CM … Hwu HG (Genes, brain, and behavior 2007) 3 22 44 58
- Association study between the TNXB locus and schizophrenia in a Japanese population. (PMID: 17192952) Tochigi M … Sasaki T (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2007) 3 22 44 58
- Genetic association between Notch4 polymorphisms and Alzheimer's disease in the Japanese population. (PMID: 17452726) Shibata N … Arai H (The journals of gerontology. Series A, Biological sciences and medical sciences 2007) 3 22 44 58
- Genetic association between Notch4 polymorphisms and Japanese schizophrenics. (PMID: 16538185) Shibata N … Arai H (Psychiatric genetics 2006) 3 22 44 58
Products for NOTCH4 Gene
- R&D Systems Antibodies for NOTCH4 (Notch-4)
- R&D Systems Proteins and Enzymes for NOTCH4 (Notch-4)
- Browse R&D Systems for biochemical assays
- R&D Systems cDNA Clones for NOTCH4 (Notch-4)
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for NOTCH4
- Search Origene for MassSpec and Protein Over-expression Lysates for NOTCH4
- Origene Custom Protein Services for NOTCH4
- Origene shrna, sirna, and RNAi products in human, mouse, rat for NOTCH4
- Browse OriGene Inhibitory RNA Products For NOTCH4
- OriGene qPCR primer pairs for NOTCH4
- OriGene CRISPR knockouts for NOTCH4
- OriGene ORF clones in human for NOTCH4
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For NOTCH4
- GenScript: Next-day shipping of latest version cDNA ORF clones for NOTCH4 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for NOTCH4
- GenScript Custom Assay Services for NOTCH4
- GenScript Custom overexpressing Cell Line Services for NOTCH4
- GenScript: Design CRISPR guide RNA sequences for NOTCH4
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for NOTCH4
- Sino Biological Human cDNA Clone for NOTCH4
- Sino Biological Recombinant Proteins for NOTCH4
- Sino Biological Cell Lysates for NOTCH4
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Recombinant Proteins
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for NOTCH4
- Novus Biologicals lysates for NOTCH4
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for NOTCH4
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Taconic Biosciences Mouse Models for NOTCH4
- Find your next knockout model in the Taconic Knockout Repository
- Genetically Engineered Models Available Immediately
- Humanized Mice
- Invitrogen Antibodies for NOTCH4
- Cyagen custom Knockout/knockin (KOKI) mouse models for NOTCH4
- VectorBuilder custom plasmid, inducible vectors for NOTCH4
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for NOTCH4
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 84 available NOTCH4 Antibodies ranked by validation data
- Compare Top NOTCH4 Antibodies
- antibodies-online: Search results for 7 available NOTCH4 Elisa Kits ranked by validation data
- Compare Top NOTCH4 Elisa Kits
- Recommended
- antibodies-online: Search results for 11 available NOTCH4 Proteins ranked by validation data
- Compare Top NOTCH4 Proteins
- GeneTex Notch4 Antibody for NOTCH4
- Search GeneTex for Proteins for NOTCH4
- Santa Cruz Biotechnology (SCBT) Antibodies for NOTCH4
- Search Santa Cruz Biotechnology (SCBT) for NOTCH4 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for NOTCH4
- Horizon Cell Lines for NOTCH4
- genomics-online: cdna clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- orf clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- genomics-online: gRNA clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- genomics-online: primer clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- genomics-online: shRNA clones - Search results for 73 available NOTCH4 gene related products
- Overview of 73 available NOTCH4 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for NOTCH4
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for NOTCH4
- GeneCopoeia miRNA 3'UTR Target clone products for NOTCH4
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NOTCH4
Sources for NOTCH4 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt