Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NKD2 Gene

Aliases for NKD2 Gene

  • Naked Cuticle Homolog 2 2 3 5
  • Dvl-Binding Protein NKD2 2 3
  • Naked Cuticle Homolog 2 (Drosophila) 2
  • Protein Naked Cuticle Homolog 2 3
  • Naked Cuticle-2 2
  • Naked-2 4
  • Naked2 3
  • HNkd2 4

External Ids for NKD2 Gene

Previous GeneCards Identifiers for NKD2 Gene

  • GC05P001220
  • GC05M001180
  • GC05P001041
  • GC05P001061
  • GC05P001062
  • GC05P001008

Summaries for NKD2 Gene

Entrez Gene Summary for NKD2 Gene

  • This gene encodes a member of a family of proteins that function as negative regulators of Wnt receptor signaling through interaction with Dishevelled family members. The encoded protein participates in the delivery of transforming growth factor alpha-containing vesicles to the cell membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]

GeneCards Summary for NKD2 Gene

NKD2 (Naked Cuticle Homolog 2) is a Protein Coding gene. Among its related pathways are Wnt Signaling Pathway and Pluripotency and Wnt / Hedgehog / Notch. Gene Ontology (GO) annotations related to this gene include calcium ion binding and growth factor binding. An important paralog of this gene is NKD1.

UniProtKB/Swiss-Prot for NKD2 Gene

  • Cell autonomous antagonist of the canonical Wnt signaling pathway. May activate a second Wnt signaling pathway that controls planar cell polarity (By similarity). Required for processing of TGFA and for targeting of TGFA to the basolateral membrane of polarized epithelial cells.

Additional gene information for NKD2 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NKD2 Gene

Genomics for NKD2 Gene

GeneHancer (GH) Regulatory Elements for NKD2 Gene

Promoters and enhancers for NKD2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05I001008 Promoter 1.5 EPDnew Ensembl 550.8 +0.2 157 0.4 CTCF RB1 BACH1 SIN3A ZBTB7B ZNF335 FOXM1 ZFHX2 GLIS2 POLR2A NKD2 LOC100506688 LPCAT1 GC05P001049
GH05I000955 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 13 -51.2 -51182 3.6 PKNOX1 SIN3A ZNF48 FOS RUNX3 MCM3 NFYC JUNB REST ZNF592 GC05P000958 NKD2 LOC100421419 LOC100132773 BRD9 ENSG00000248949 LOC100506688 ENSG00000248994 GC05M000954 GC05M000955
GH05I000962 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 7.1 -44.8 -44823 2.5 HDGF PKNOX1 ATF1 ARNT TCF12 ZNF766 ATF7 RUNX3 JUNB ATF4 CTD-3080P12.3 NKD2 LOC100506688 GC05M000954 PIR47702
GH05I001004 Promoter/Enhancer 1.4 Ensembl ENCODE 7 -4.3 -4253 1.2 ATF1 ZNF493 SIN3A GLI4 ZNF48 ZNF121 GLIS2 ZNF213 KLF7 ATF7 ENSG00000272347 SDHAP3 BRD9 LOC100506688 LOC728613 ENSG00000271119 ENSG00000248949 NKD2
GH05I001067 Enhancer 1.1 FANTOM5 ENCODE 7.5 +59.0 59041 0.4 SMAD1 ATF1 ARNT TCF12 ZNF766 GATA2 ATF7 NCOA1 MBD2 MEF2D NKD2 ZDHHC11 MIR4635 GC05M001107 SLC12A7
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around NKD2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the NKD2 gene promoter:

Genomic Locations for NKD2 Gene

Genomic Locations for NKD2 Gene
30,124 bases
Plus strand

Genomic View for NKD2 Gene

Genes around NKD2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NKD2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NKD2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NKD2 Gene

Proteins for NKD2 Gene

  • Protein details for NKD2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein naked cuticle homolog 2
    Protein Accession:
    Secondary Accessions:
    • Q96EK8
    • Q9BSN0

    Protein attributes for NKD2 Gene

    451 amino acids
    Molecular mass:
    50055 Da
    Quaternary structure:
    • Interacts with DVL1, DVL2, DVL3 and PPP2R3A (By similarity). Interacts with RNF25 and TGFA (via cytoplasmic domain).

    Alternative splice isoforms for NKD2 Gene


neXtProt entry for NKD2 Gene

Post-translational modifications for NKD2 Gene

  • Ubiquitinated, leading to rapid proteasomal degradation. Interaction with TGFA interferes with RNF25 binding and protects against ubiquitination mediated by RNF25.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for NKD2 Gene

No data available for DME Specific Peptides for NKD2 Gene

Domains & Families for NKD2 Gene

Gene Families for NKD2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for NKD2 Gene

Suggested Antigen Peptide Sequences for NKD2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • The N-terminal domain comprising the first 217 amino acid residues is mostly unstructured.
  • Belongs to the NKD family.
  • The N-terminal domain comprising the first 217 amino acid residues is mostly unstructured.
  • Belongs to the NKD family.
genes like me logo Genes that share domains with NKD2: view

Function for NKD2 Gene

Molecular function for NKD2 Gene

UniProtKB/Swiss-Prot Function:
Cell autonomous antagonist of the canonical Wnt signaling pathway. May activate a second Wnt signaling pathway that controls planar cell polarity (By similarity). Required for processing of TGFA and for targeting of TGFA to the basolateral membrane of polarized epithelial cells.

Phenotypes From GWAS Catalog for NKD2 Gene

Gene Ontology (GO) - Molecular Function for NKD2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IEA --
GO:0005515 protein binding IPI 15064403
GO:0019838 growth factor binding IPI 15064403
GO:0031625 ubiquitin protein ligase binding IPI 18757723
GO:0032036 myosin heavy chain binding IPI 18504258
genes like me logo Genes that share ontologies with NKD2: view
genes like me logo Genes that share phenotypes with NKD2: view

Animal Models for NKD2 Gene

MGI Knock Outs for NKD2:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for NKD2 Gene

Localization for NKD2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for NKD2 Gene

Cell membrane. Cytoplasm. Cytoplasmic vesicle.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for NKD2 gene
Compartment Confidence
plasma membrane 4
nucleus 3
cytosol 2

Gene Ontology (GO) - Cellular Components for NKD2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005886 plasma membrane IDA 18504258
GO:0016020 membrane IEA --
GO:0016323 basolateral plasma membrane IDA 17553928
GO:0016328 colocalizes_with lateral plasma membrane IDA 20177058
genes like me logo Genes that share ontologies with NKD2: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for NKD2 Gene

Pathways & Interactions for NKD2 Gene

genes like me logo Genes that share pathways with NKD2: view

Pathways by source for NKD2 Gene

2 GeneTex pathways for NKD2 Gene
1 KEGG pathway for NKD2 Gene
1 Cell Signaling Technology pathway for NKD2 Gene

Gene Ontology (GO) - Biological Process for NKD2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport IEA --
GO:0006887 exocytosis IEA --
GO:0010954 positive regulation of protein processing IDA 15064403
GO:0016055 Wnt signaling pathway IEA --
GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process IMP 20177058
genes like me logo Genes that share ontologies with NKD2: view

No data available for SIGNOR curated interactions for NKD2 Gene

Drugs & Compounds for NKD2 Gene

No Compound Related Data Available

Transcripts for NKD2 Gene

Unigene Clusters for NKD2 Gene

Naked cuticle homolog 2 (Drosophila):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for NKD2 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10a · 10b
SP1: - -
SP2: - - -
SP4: -

Relevant External Links for NKD2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for NKD2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for NKD2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for NKD2 Gene

This gene is overexpressed in Lung (x9.7) and Spleen (x5.1).

NURSA nuclear receptor signaling pathways regulating expression of NKD2 Gene:


SOURCE GeneReport for Unigene cluster for NKD2 Gene:


mRNA Expression by UniProt/SwissProt for NKD2 Gene:

Tissue specificity: Expressed in kidney, lung, pancreas and spleen.
genes like me logo Genes that share expression patterns with NKD2: view

Primer Products

No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for NKD2 Gene

Orthologs for NKD2 Gene

This gene was present in the common ancestor of animals.

Orthologs for NKD2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia NKD2 33 34
  • 95.25 (n)
(Rattus norvegicus)
Mammalia Nkd2 33
  • 79.67 (n)
(Canis familiaris)
Mammalia NKD2 33 34
  • 79.55 (n)
(Mus musculus)
Mammalia Nkd2 33 16 34
  • 78.89 (n)
(Bos Taurus)
Mammalia NKD2 33 34
  • 78.43 (n)
(Monodelphis domestica)
Mammalia NKD2 34
  • 68 (a)
(Ornithorhynchus anatinus)
Mammalia NKD2 34
  • 63 (a)
(Danio rerio)
Actinopterygii nkd2b 33
  • 55.15 (n)
nkd2a 34
  • 50 (a)
fruit fly
(Drosophila melanogaster)
Insecta nkd 34
  • 11 (a)
Species where no ortholog for NKD2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for NKD2 Gene

Gene Tree for NKD2 (if available)
Gene Tree for NKD2 (if available)

Paralogs for NKD2 Gene

Paralogs for NKD2 Gene

(1) SIMAP similar genes for NKD2 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with NKD2: view

Variants for NKD2 Gene

Sequence variations from dbSNP and Humsavar for NKD2 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1000112320 -- 1,029,590(+) G/A genic_upstream_transcript_variant, intron_variant
rs1000184663 -- 1,028,647(+) G/A genic_upstream_transcript_variant, intron_variant
rs1000202239 -- 1,008,457(+) G/A/C upstream_transcript_variant
rs1000252795 -- 1,010,022(+) G/T genic_upstream_transcript_variant, intron_variant
rs1000362582 -- 1,035,921(+) GTGGCTGGGTGGCTGGGGTGTGGCTGG/GTGGCTGG intron_variant

Structural Variations from Database of Genomic Variants (DGV) for NKD2 Gene

Variant ID Type Subtype PubMed ID
dgv1065e214 CNV loss 21293372
dgv686n27 CNV loss 19166990
dgv9518n54 CNV loss 21841781
dgv9519n54 CNV gain 21841781
dgv9520n54 CNV gain+loss 21841781
dgv9521n54 CNV loss 21841781
dgv9522n54 CNV loss 21841781
esv1007931 CNV deletion 20482838
esv2669088 CNV deletion 23128226
esv2674300 CNV deletion 23128226
esv2729379 CNV deletion 23290073
esv2729380 CNV deletion 23290073
esv2729381 CNV deletion 23290073
esv2729382 CNV deletion 23290073
esv2741210 CNV deletion 23290073
esv27512 CNV gain+loss 19812545
esv2759316 CNV gain+loss 17122850
esv3603788 CNV loss 21293372
esv3603789 CNV gain 21293372
esv3603792 CNV gain 21293372
esv3603794 CNV loss 21293372
esv3894109 CNV gain 25118596
esv3894110 CNV loss 25118596
esv990038 CNV deletion 20482838
esv999700 CNV gain 20482838
nsv10654 CNV gain+loss 18304495
nsv1074794 CNV deletion 25765185
nsv1133013 OTHER inversion 24896259
nsv1135951 CNV deletion 24896259
nsv1147234 OTHER inversion 26484159
nsv329395 CNV deletion 16902084
nsv428459 CNV gain+loss 18775914
nsv461896 CNV loss 19166990
nsv469577 CNV loss 16826518
nsv470984 CNV loss 18288195
nsv470985 CNV gain 18288195
nsv527182 CNV loss 19592680
nsv596629 CNV gain 21841781
nsv596788 CNV loss 21841781
nsv596790 CNV loss 21841781
nsv596798 CNV loss 21841781
nsv596803 CNV loss 21841781
nsv822953 CNV gain 20364138
nsv950627 CNV deletion 24416366

Variation tolerance for NKD2 Gene

Residual Variation Intolerance Score: 82% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.18; 51.94% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for NKD2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for NKD2 Gene

Disorders for NKD2 Gene

Additional Disease Information for NKD2

No disorders were found for NKD2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for NKD2 Gene

Publications for NKD2 Gene

  1. Vertebrate proteins related to Drosophila Naked Cuticle bind Dishevelled and antagonize Wnt signaling. (PMID: 11356022) Wharton KA … Scott MP (Developmental biology 2001) 2 3 4 22 58
  2. Molecular cloning, gene structure, and expression analyses of NKD1 and NKD2. (PMID: 11604995) Katoh M (International journal of oncology 2001) 2 3 4 22 58
  3. EGF receptor-independent action of TGF-alpha protects Naked2 from AO7-mediated ubiquitylation and proteasomal degradation. (PMID: 18757723) Ding W … Coffey RJ (Proceedings of the National Academy of Sciences of the United States of America 2008) 3 4 58
  4. Naked2 acts as a cargo recognition and targeting protein to ensure proper delivery and fusion of TGF-alpha containing exocytic vesicles at the lower lateral membrane of polarized MDCK cells. (PMID: 17553928) Li C … Coffey RJ (Molecular biology of the cell 2007) 3 4 58
  5. Structural studies of human Naked2: a biologically active intrinsically unstructured protein. (PMID: 17045239) Hu T … Coffey RJ (Biochemical and biophysical research communications 2006) 3 4 58

Products for NKD2 Gene

Sources for NKD2 Gene

Loading form....