Free for academic non-profit institutions. Other users need a Commercial license
Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
NEFH (Neurofilament Heavy) is a Protein Coding gene. Diseases associated with NEFH include Charcot-Marie-Tooth Disease, Axonal, Type 2Cc and Amyotrophic Lateral Sclerosis 1. Among its related pathways are Amyotrophic lateral sclerosis (ALS) and Neuroscience. Gene Ontology (GO) annotations related to this gene include protein kinase binding and microtubule binding.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005200 | structural constituent of cytoskeleton | ISS | -- |
GO:0008017 | microtubule binding | TAS | 17498690 |
GO:0019894 | kinesin binding | TAS | 17498690 |
GO:0019901 | protein kinase binding | IPI | 9313898 |
GO:0030674 | protein binding, bridging | ISS | -- |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005737 | cytoplasm | ISS,IEA | -- |
GO:0005856 | cytoskeleton | IDA | 24327345 |
GO:0005882 | intermediate filament | IEA | -- |
GO:0005883 | neurofilament | NAS | 3138108 |
GO:0014069 | postsynaptic density | IEA | -- |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Amyotrophic lateral sclerosis (ALS) | ||
2 | Neuroscience | ||
3 | Cytoskeleton remodeling Neurofilaments | ||
4 | Association Between Physico-Chemical Features and Toxicity Associated Pathways |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000226 | microtubule cytoskeleton organization | IEA | -- |
GO:0007409 | axonogenesis | TAS | 17498690 |
GO:0030031 | cell projection assembly | TAS | 17498690 |
GO:0033693 | neurofilament bundle assembly | IMP | 7536898 |
GO:0045104 | intermediate filament cytoskeleton organization | IEA | -- |
Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
---|
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
---|
ExUns: | 1a | · | 1b | ^ | 2 | ^ | 3 | ^ | 4a | · | 4b |
---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | |||||||||||
SP2: |
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | NEFH 33 32 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | NEFH 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | NEFH 33 32 |
|
OneToOne | |
rat (Rattus norvegicus) |
Mammalia | Nefh 32 |
|
||
mouse (Mus musculus) |
Mammalia | Nefh 17 33 32 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | NEFH 33 |
|
OneToOne | |
platypus (Ornithorhynchus anatinus) |
Mammalia | -- 33 |
|
ManyToMany | |
chicken (Gallus gallus) |
Aves | NEFH 33 32 |
|
OneToOne | |
lizard (Anolis carolinensis) |
Reptilia | NEFH 33 |
|
OneToOne | |
zebrafish (Danio rerio) |
Actinopterygii | nefmb 33 |
|
ManyToMany | |
CABZ01079764.1 33 |
|
ManyToMany | |||
ngs 33 |
|
ManyToMany | |||
si:dkey-27m7.4 33 |
|
ManyToMany | |||
zgc:136930 33 |
|
ManyToMany | |||
wu:fb15e04 33 |
|
ManyToMany | |||
zgc:172323 33 |
|
ManyToMany | |||
worm (Caenorhabditis elegans) |
Secernentea | ifa-1 33 |
|
ManyToMany | |
ifa-4 33 |
|
ManyToMany | |||
mua-6 33 |
|
ManyToMany | |||
ifa-3 33 |
|
ManyToMany | |||
ifb-1 33 |
|
ManyToMany | |||
ifb-2 33 |
|
ManyToMany | |||
ifd-2 33 |
|
ManyToMany | |||
ifc-1 33 |
|
ManyToMany | |||
ifd-1 33 |
|
ManyToMany | |||
ifc-2 33 |
|
ManyToMany | |||
sea squirt (Ciona savignyi) |
Ascidiacea | -- 33 |
|
ManyToMany | |
CSA.10989 33 |
|
ManyToMany | |||
CSA.8134 33 |
|
ManyToMany |
SNP ID | Clin | Chr 22 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs114263951 | likely-benign, Amyotrophic lateral sclerosis type 1 | 29,489,380(+) | C/T | coding_sequence_variant, intron_variant, synonymous_variant | |
rs139580489 | uncertain-significance, Inborn genetic diseases | 29,489,499(+) | C/T | coding_sequence_variant, intron_variant, missense_variant | |
rs147489453 | benign, Amyotrophic lateral sclerosis type 1 | 29,489,579(+) | AAGTCCCCTGAGAAGGCCAAGTCCCC/AAGTCCCC/AAGTCCCCTGAGAAGGCCAAGTCCCCTGAGAAGGCCAAGTCCCC/AAGTCCCCTGAGAAGGCCAAGTCCCCTGAGAAGGCCAAGTCCCCTGAGAAGGCCAAGTCCCC | coding_sequence_variant, inframe_deletion, inframe_insertion, splice_acceptor_variant | |
rs165602 | not-provided, benign, not provided, Amyotrophic lateral sclerosis type 1, - | 29,490,054(+) | A/C/T | coding_sequence_variant, missense_variant | |
rs165625 | not-provided, benign, not provided, Amyotrophic lateral sclerosis type 1 | 29,490,424(+) | A/G/T | coding_sequence_variant, synonymous_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
esv3647536 | CNV | gain | 21293372 |
esv3893473 | CNV | loss | 25118596 |
nsv1062039 | CNV | gain | 25217958 |
nsv1110864 | OTHER | inversion | 24896259 |
nsv438344 | CNV | loss | 16468122 |
nsv524511 | CNV | loss | 19592680 |
Disorder | Aliases | PubMed IDs |
---|---|---|
charcot-marie-tooth disease, axonal, type 2cc |
|
|
amyotrophic lateral sclerosis 1 |
|
|
lateral sclerosis |
|
|
motor neuron disease |
|
|
sennetsu fever |
|
|