NEFH Gene (Protein Coding)

Neurofilament Heavy

GC22P029480
GIFtS:
47
Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal da... See more...

Aliases for NEFH Gene

Aliases for NEFH Gene

  • Neurofilament Heavy 2 3 5
  • Neurofilament Heavy Polypeptide 2 3 4
  • Neurofilament, Heavy Polypeptide 200kDa 2 3
  • Neurofilament Triplet H Protein 3 4
  • 200 KDa Neurofilament Protein 3 4
  • NF-H 3 4
  • NFH 3 4
  • KIAA0845 4
  • CMT2CC 3

External Ids for NEFH Gene

Previous GeneCards Identifiers for NEFH Gene

  • GC22P026572
  • GC22P028191
  • GC22P028200
  • GC22P029876
  • GC22P012839

Summaries for NEFH Gene

Entrez Gene Summary for NEFH Gene

  • Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]

GeneCards Summary for NEFH Gene

NEFH (Neurofilament Heavy) is a Protein Coding gene. Diseases associated with NEFH include Charcot-Marie-Tooth Disease, Axonal, Type 2Cc and Amyotrophic Lateral Sclerosis 1. Among its related pathways are Amyotrophic lateral sclerosis (ALS) and Neuroscience. Gene Ontology (GO) annotations related to this gene include protein kinase binding and microtubule binding.

UniProtKB/Swiss-Prot Summary for NEFH Gene

  • Neurofilaments usually contain three intermediate filament proteins: L, M, and H which are involved in the maintenance of neuronal caliber. NF-H has an important function in mature axons that is not subserved by the two smaller NF proteins.

Additional gene information for NEFH Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for NEFH Gene

Genomics for NEFH Gene

GeneHancer (GH) Regulatory Elements for NEFH Gene

Promoters and enhancers for NEFH Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around NEFH on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the NEFH gene promoter:
  • AhR
  • AML1a
  • Arnt
  • GR
  • GR-alpha
  • p53
  • Pax-5
  • SRF
  • SRF (504 AA)

Genomic Locations for NEFH Gene

Genomic Locations for NEFH Gene
chr22:29,480,192-29,491,390
(GRCh38/hg38)
Size:
11,199 bases
Orientation:
Plus strand
chr22:29,876,181-29,887,379
(GRCh37/hg19)
Size:
11,199 bases
Orientation:
Plus strand

Genomic View for NEFH Gene

Genes around NEFH on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NEFH Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NEFH Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for NEFH Gene

Proteins for NEFH Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for NEFH Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P12036-NFH_HUMAN
    Recommended name:
    Neurofilament heavy polypeptide
    Protein Accession:
    P12036
    Secondary Accessions:
    • B4DYY4
    • Q96HF8
    • Q9UJS7
    • Q9UQ14

    Protein attributes for NEFH Gene

    Size:
    1026 amino acids
    Molecular mass:
    112479 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAA74868.2; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=BAG63896.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for NEFH Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for NEFH Gene

Protein Expression for NEFH Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for NEFH Gene

  • There are a number of repeats of the tripeptide K-S-P, NFH is phosphorylated on a number of the serines in this motif. It is thought that phosphorylation of NFH results in the formation of interfilament cross bridges that are important in the maintenance of axonal caliber.
  • Phosphorylation seems to play a major role in the functioning of the larger neurofilament polypeptides (NF-M and NF-H), the levels of phosphorylation being altered developmentally and coincidentally with a change in the neurofilament function.
  • Phosphorylated in the head and rod regions by the PKC kinase PKN1, leading to the inhibition of polymerization.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for NEFH Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for NEFH Gene

Domains & Families for NEFH Gene

Gene Families for NEFH Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for NEFH Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for NEFH Gene

GenScript: Design optimal peptide antigens:
  • Neurofilament triplet H protein (NFH_HUMAN)
  • Neurofilament heavy subunit (Q16070_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P12036

UniProtKB/Swiss-Prot:

NFH_HUMAN :
  • Belongs to the intermediate filament family.
Family:
  • Belongs to the intermediate filament family.
genes like me logo Genes that share domains with NEFH: view

Function for NEFH Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for NEFH Gene

UniProtKB/Swiss-Prot Function:
Neurofilaments usually contain three intermediate filament proteins: L, M, and H which are involved in the maintenance of neuronal caliber. NF-H has an important function in mature axons that is not subserved by the two smaller NF proteins.
GENATLAS Biochemistry:
neurofilament,heavy polypeptide (200kDa),with a deletion of the tail primarily involved in uncommon forms of amyotrophic lateral sclerosis

Phenotypes From GWAS Catalog for NEFH Gene

Gene Ontology (GO) - Molecular Function for NEFH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005200 structural constituent of cytoskeleton ISS --
GO:0008017 microtubule binding TAS 17498690
GO:0019894 kinesin binding TAS 17498690
GO:0019901 protein kinase binding IPI 9313898
GO:0030674 protein binding, bridging ISS --
genes like me logo Genes that share ontologies with NEFH: view
genes like me logo Genes that share phenotypes with NEFH: view

Human Phenotype Ontology for NEFH Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for NEFH Gene

MGI Knock Outs for NEFH:

Animal Model Products

CRISPR Products

miRNA for NEFH Gene

miRTarBase miRNAs that target NEFH

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NEFH

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for NEFH Gene

Localization for NEFH Gene

Subcellular locations from UniProtKB/Swiss-Prot for NEFH Gene

Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for NEFH gene
Compartment Confidence
cytoskeleton 5
nucleus 2
cytosol 2
extracellular 1
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoli (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for NEFH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm ISS,IEA --
GO:0005856 cytoskeleton IDA 24327345
GO:0005882 intermediate filament IEA --
GO:0005883 neurofilament NAS 3138108
GO:0014069 postsynaptic density IEA --
genes like me logo Genes that share ontologies with NEFH: view

Pathways & Interactions for NEFH Gene

genes like me logo Genes that share pathways with NEFH: view

Pathways by source for NEFH Gene

1 KEGG pathway for NEFH Gene
1 GeneGo (Thomson Reuters) pathway for NEFH Gene
1 Cell Signaling Technology pathway for NEFH Gene

SIGNOR curated interactions for NEFH Gene

Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for NEFH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000226 microtubule cytoskeleton organization IEA --
GO:0007409 axonogenesis TAS 17498690
GO:0030031 cell projection assembly TAS 17498690
GO:0033693 neurofilament bundle assembly IMP 7536898
GO:0045104 intermediate filament cytoskeleton organization IEA --
genes like me logo Genes that share ontologies with NEFH: view

Drugs & Compounds for NEFH Gene

Products:

  1. Drug

(2) Drugs for NEFH Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(3) Additional Compounds for NEFH Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with NEFH: view

Transcripts for NEFH Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for NEFH Gene

(1) REFSEQ mRNAs :
(11) Additional mRNA sequences :
(66) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NEFH

Alternative Splicing Database (ASD) splice patterns (SP) for NEFH Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b
SP1:
SP2:

Relevant External Links for NEFH Gene

GeneLoc Exon Structure for
NEFH
ECgene alternative splicing isoforms for
NEFH

Expression for NEFH Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for NEFH Gene

mRNA expression in normal human tissues for NEFH Gene
mRNA expression by BioGPS for NEFH GenemRNA expression by GTEx for NEFH Gene

mRNA differential expression in normal tissues according to GTEx for NEFH Gene

This gene is overexpressed in Prostate (x9.2), Brain - Substantia nigra (x6.3), Brain - Frontal Cortex (BA9) (x5.6), Brain - Anterior cingulate cortex (BA24) (x4.5), Brain - Cortex (x4.4), and Brain - Hypothalamus (x4.2).

Protein differential expression in normal tissues from HIPED for NEFH Gene

This gene is overexpressed in Spinal cord (55.7) and Frontal cortex (7.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for NEFH Gene



NURSA nuclear receptor signaling pathways regulating expression of NEFH Gene:

NEFH

SOURCE GeneReport for Unigene cluster for NEFH Gene:

Hs.198760

Evidence on tissue expression from TISSUES for NEFH Gene

  • Nervous system(4.9)
  • Eye(4.5)
  • Liver(4.4)
  • Gall bladder(2.7)
  • Intestine(2.4)
  • Lung(2.3)
  • Adrenal gland(2.2)
  • Blood(2.1)
  • Heart(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for NEFH Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • epiglottis
  • face
  • head
  • jaw
  • larynx
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • pharynx
  • skull
  • tongue
  • vocal cord
Thorax:
  • bronchus
  • clavicle
  • esophagus
  • heart
  • lung
  • scapula
  • trachea
Abdomen:
  • biliary tract
  • liver
  • stomach
Limb:
  • arm
  • digit
  • finger
  • foot
  • forearm
  • hand
  • humerus
  • lower limb
  • shin
  • shoulder
  • thigh
  • toe
  • upper limb
General:
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with NEFH: view

No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for NEFH Gene

Orthologs for NEFH Gene

This gene was present in the common ancestor of animals.

Orthologs for NEFH Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia NEFH 33 32
  • 99.02 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia NEFH 33 32
  • 87.03 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia NEFH 33 32
  • 86.47 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Nefh 32
  • 83.97 (n)
mouse
(Mus musculus)
 Mammalia Nefh 17 33 32
  • 82.42 (n)
oppossum
(Monodelphis domestica)
 Mammalia NEFH 33
  • 67 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia -- 33
  • 22 (a)
 ManyToMany
chicken
(Gallus gallus)
 Aves NEFH 33 32
  • 70.22 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia NEFH 33
  • 41 (a)
 OneToOne
zebrafish
(Danio rerio)
 Actinopterygii nefmb 33
  • 39 (a)
 ManyToMany
CABZ01079764.1 33
  • 32 (a)
 ManyToMany
ngs 33
  • 25 (a)
 ManyToMany
si:dkey-27m7.4 33
  • 24 (a)
 ManyToMany
zgc:136930 33
  • 21 (a)
 ManyToMany
wu:fb15e04 33
  • 17 (a)
 ManyToMany
zgc:172323 33
  • 15 (a)
 ManyToMany
worm
(Caenorhabditis elegans)
 Secernentea ifa-1 33
  • 22 (a)
 ManyToMany
ifa-4 33
  • 20 (a)
 ManyToMany
mua-6 33
  • 20 (a)
 ManyToMany
ifa-3 33
  • 19 (a)
 ManyToMany
ifb-1 33
  • 19 (a)
 ManyToMany
ifb-2 33
  • 18 (a)
 ManyToMany
ifd-2 33
  • 16 (a)
 ManyToMany
ifc-1 33
  • 15 (a)
 ManyToMany
ifd-1 33
  • 15 (a)
 ManyToMany
ifc-2 33
  • 8 (a)
 ManyToMany
sea squirt
(Ciona savignyi)
 Ascidiacea -- 33
  • 31 (a)
 ManyToMany
CSA.10989 33
  • 28 (a)
 ManyToMany
CSA.8134 33
  • 26 (a)
 ManyToMany
Species where no ortholog for NEFH was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for NEFH Gene

ENSEMBL:
Gene Tree for NEFH (if available)
TreeFam:
Gene Tree for NEFH (if available)
Aminode:
Evolutionary constrained regions (ECRs) for NEFH: view image

Paralogs for NEFH Gene

(7) SIMAP similar genes for NEFH Gene using alignment to 2 proteins:

  • NFH_HUMAN
  • Q16070_HUMAN

Pseudogenes.org Pseudogenes for NEFH Gene

genes like me logo Genes that share paralogs with NEFH: view

No data available for Paralogs for NEFH Gene

Variants for NEFH Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Polymorphic Variants from UniProtKB/Swiss-Prot for NEFH Gene

NFH_HUMAN-P12036
The number of repeats is shown to vary between 29 and 30.

Sequence variations from dbSNP and Humsavar for NEFH Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs114263951 likely-benign, Amyotrophic lateral sclerosis type 1 29,489,380(+) C/T coding_sequence_variant, intron_variant, synonymous_variant
rs139580489 uncertain-significance, Inborn genetic diseases 29,489,499(+) C/T coding_sequence_variant, intron_variant, missense_variant
rs147489453 benign, Amyotrophic lateral sclerosis type 1 29,489,579(+) AAGTCCCCTGAGAAGGCCAAGTCCCC/AAGTCCCC/AAGTCCCCTGAGAAGGCCAAGTCCCCTGAGAAGGCCAAGTCCCC/AAGTCCCCTGAGAAGGCCAAGTCCCCTGAGAAGGCCAAGTCCCCTGAGAAGGCCAAGTCCCC coding_sequence_variant, inframe_deletion, inframe_insertion, splice_acceptor_variant
rs165602 not-provided, benign, not provided, Amyotrophic lateral sclerosis type 1, - 29,490,054(+) A/C/T coding_sequence_variant, missense_variant
rs165625 not-provided, benign, not provided, Amyotrophic lateral sclerosis type 1 29,490,424(+) A/G/T coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for NEFH Gene

Variant ID Type Subtype PubMed ID
esv3647536 CNV gain 21293372
esv3893473 CNV loss 25118596
nsv1062039 CNV gain 25217958
nsv1110864 OTHER inversion 24896259
nsv438344 CNV loss 16468122
nsv524511 CNV loss 19592680

Variation tolerance for NEFH Gene

Residual Variation Intolerance Score: 60.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.82; 86.88% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for NEFH Gene

Human Gene Mutation Database (HGMD)
NEFH
SNPedia medical, phenotypic, and genealogical associations of SNPs for
NEFH

SNP Genotyping and Copy Number Assay Products

Disorders for NEFH Gene

MalaCards: The human disease database

(10) MalaCards diseases for NEFH Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
charcot-marie-tooth disease, axonal, type 2cc
  • cmt2cc
amyotrophic lateral sclerosis 1
  • als1
lateral sclerosis
  • adult-onset primary lateral sclerosis
motor neuron disease
  • anterior horn cell disease
sennetsu fever
  • sennetsu ehrlichiosis
- elite association - COSMIC cancer census association via MalaCards
Search NEFH in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

NFH_HUMAN
  • Amyotrophic lateral sclerosis (ALS) [MIM:105400]: A neurodegenerative disorder affecting upper motor neurons in the brain and lower motor neurons in the brain stem and spinal cord, resulting in fatal paralysis. Sensory abnormalities are absent. The pathologic hallmarks of the disease include pallor of the corticospinal tract due to loss of motor neurons, presence of ubiquitin-positive inclusions within surviving motor neurons, and deposition of pathologic aggregates. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of the cases. {ECO:0000269 PubMed:7849698}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
  • Charcot-Marie-Tooth disease 2CC (CMT2CC) [MIM:616924]: An axonal form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Neuropathies of the CMT2 group are characterized by signs of axonal degeneration in the absence of obvious myelin alterations, normal or slightly reduced nerve conduction velocities, and progressive distal muscle weakness and atrophy. {ECO:0000269 PubMed:27040688}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for NEFH

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with NEFH: view

No data available for Genatlas for NEFH Gene

Publications for NEFH Gene

  1. Cryptic Amyloidogenic Elements in the 3' UTRs of Neurofilament Genes Trigger Axonal Neuropathy. (PMID: 27040688) Rebelo AP … Zuchner S (American journal of human genetics 2016) 3 4 56
  2. Polymorphisms in genes involved in neurodevelopment may be associated with altered brain morphology in schizophrenia: preliminary evidence. (PMID: 19054571) Gregório SP … Dias-Neto E (Psychiatry research 2009) 3 43 56
  3. Pin1-dependent prolyl isomerization modulates the stress-induced phosphorylation of high molecular weight neurofilament protein. (PMID: 18635547) Rudrabhatla P … Pant HC (The Journal of biological chemistry 2008) 3 23 56
  4. Detection of phosphorylated NF-H in the cerebrospinal fluid and blood of aneurysmal subarachnoid hemorrhage patients. (PMID: 18319731) Lewis SB … Shaw G (Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 2008) 3 23 56
  5. Inhibition of Pin1 reduces glutamate-induced perikaryal accumulation of phosphorylated neurofilament-H in neurons. (PMID: 17626162) Kesavapany S … Pant HC (Molecular biology of the cell 2007) 3 23 56

ExternalLinks

View latest publications for NEFH gene in Mastermind

Products for NEFH Gene

  • Addgene plasmids for NEFH

Sources for NEFH Gene