Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NAGLU Gene

Aliases for NAGLU Gene

  • N-Acetyl-Alpha-Glucosaminidase 2 3 4 5
  • N-Acetylglucosaminidase, Alpha 2 3
  • Alpha-N-Acetylglucosaminidase 3 4
  • NAG 3 4
  • Testicular Tissue Protein Li 18 3
  • Sanfilippo Disease IIIB 2
  • EC 4
  • MPS-IIIB 3
  • UFHSD1 4
  • CMT2V 3
  • MPS3B 3
  • UFHSD 3

External Ids for NAGLU Gene

Previous GeneCards Identifiers for NAGLU Gene

  • GC17M040212
  • GC17M042827
  • GC17P040596
  • GC17P041061
  • GC17P037941
  • GC17P040687
  • GC17P036452

Summaries for NAGLU Gene

Entrez Gene Summary for NAGLU Gene

  • This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]

GeneCards Summary for NAGLU Gene

NAGLU (N-Acetyl-Alpha-Glucosaminidase) is a Protein Coding gene. Diseases associated with NAGLU include Charcot-Marie-Tooth Disease, Axonal, Type 2V and Mucopolysaccharidosis, Type Iiib. Among its related pathways are Chondroitin sulfate/dermatan sulfate metabolism and Glycosaminoglycan metabolism. Gene Ontology (GO) annotations related to this gene include alpha-N-acetylglucosaminidase activity.

UniProtKB/Swiss-Prot for NAGLU Gene

Tocris Summary for NAGLU Gene

Additional gene information for NAGLU Gene

No data available for CIViC summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NAGLU Gene

Genomics for NAGLU Gene

GeneHancer (GH) Regulatory Elements for NAGLU Gene

Promoters and enhancers for NAGLU Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around NAGLU on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the NAGLU gene promoter:
  • GATA-2
  • GR
  • GR-alpha
  • GR-beta
  • PPAR-gamma1
  • PPAR-gamma2
  • STAT3

Genomic Locations for NAGLU Gene

Genomic Locations for NAGLU Gene
8,517 bases
Plus strand
8,517 bases
Plus strand

Genomic View for NAGLU Gene

Genes around NAGLU on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NAGLU Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NAGLU Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NAGLU Gene

Proteins for NAGLU Gene

  • Protein details for NAGLU Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:

    Protein attributes for NAGLU Gene

    743 amino acids
    Molecular mass:
    82266 Da
    Quaternary structure:
    • Monomer and homodimer.

    Three dimensional structures from OCA and Proteopedia for NAGLU Gene

neXtProt entry for NAGLU Gene

Post-translational modifications for NAGLU Gene

  • Glycosylation at isoforms=261, posLast=503503, posLast=435435, posLast=532532, isoforms=272, and isoforms=526
  • Ubiquitination at isoforms=59
  • Modification sites at PhosphoSitePlus
  • Glycosylation from GlyConnect
    • ANAG_HUMAN (803)

No data available for DME Specific Peptides for NAGLU Gene

Domains & Families for NAGLU Gene

Gene Families for NAGLU Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted intracellular proteins
  • Predicted secreted proteins

Protein Domains for NAGLU Gene

Suggested Antigen Peptide Sequences for NAGLU Gene

GenScript: Design optimal peptide antigens:
  • N-acetyl-alpha-glucosaminidase (ANAG_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the glycosyl hydrolase 89 family.
  • Belongs to the glycosyl hydrolase 89 family.
genes like me logo Genes that share domains with NAGLU: view

Function for NAGLU Gene

Molecular function for NAGLU Gene

UniProtKB/Swiss-Prot Function:
Involved in the degradation of heparan sulfate.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=Hydrolysis of terminal non-reducing N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides.; EC=;.
GENATLAS Biochemistry:
acetyl-glucosaminidase,alpha-N,77/82kDa,lysosomal,acting on heparan sulfate,catalyzing the fifth step of degradation of glycosaminoglycans (mucopolysaccharides)

Enzyme Numbers (IUBMB) for NAGLU Gene

Phenotypes From GWAS Catalog for NAGLU Gene

Gene Ontology (GO) - Molecular Function for NAGLU Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004561 alpha-N-acetylglucosaminidase activity TAS --
GO:0016787 hydrolase activity IEA --
GO:0016798 hydrolase activity, acting on glycosyl bonds IEA --
genes like me logo Genes that share ontologies with NAGLU: view
genes like me logo Genes that share phenotypes with NAGLU: view

Human Phenotype Ontology for NAGLU Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for NAGLU Gene

MGI Knock Outs for NAGLU:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NAGLU

No data available for miRNA , Transcription Factor Targets and HOMER Transcription for NAGLU Gene

Localization for NAGLU Gene

Subcellular locations from UniProtKB/Swiss-Prot for NAGLU Gene


Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for NAGLU gene
Compartment Confidence
extracellular 5
lysosome 5
endoplasmic reticulum 1
plasma membrane 0
mitochondrion 0

Gene Ontology (GO) - Cellular Components for NAGLU Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005764 lysosome TAS 8650226
GO:0043202 lysosomal lumen TAS --
GO:0070062 extracellular exosome IDA 21082674
genes like me logo Genes that share ontologies with NAGLU: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for NAGLU Gene

Pathways & Interactions for NAGLU Gene

genes like me logo Genes that share pathways with NAGLU: view

Pathways by source for NAGLU Gene

Gene Ontology (GO) - Biological Process for NAGLU Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006027 glycosaminoglycan catabolic process TAS --
GO:0007040 lysosome organization IEA --
GO:0007399 nervous system development TAS 8650226
GO:0008152 metabolic process IEA --
GO:0021680 cerebellar Purkinje cell layer development IEA --
genes like me logo Genes that share ontologies with NAGLU: view

No data available for SIGNOR curated interactions for NAGLU Gene

Drugs & Compounds for NAGLU Gene

(81) Drugs for NAGLU Gene - From: DrugBank, DGIdb, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
N-Acetyl-D-glucosamine Approved, Investigational Nutra Target, activator 0
Human calcitonin Approved, Investigational Pharma Enzyme, substrate 0
Water Approved Pharma 0
Flurofamide Pharma Urease inhibitor 0
SCH 51344 Pharma MTH1 inhibitor, Potent MTH1 inhibitor 0

(39) Additional Compounds for NAGLU Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs

(3) Tocris Compounds for NAGLU Gene

Compound Action Cas Number
Flurofamide Urease inhibitor 70788-28-2
SCH 51344 Potent MTH1 inhibitor 171927-40-5
WWL 70 Potent ABHD6 inhibitor 947669-91-2
genes like me logo Genes that share compounds with NAGLU: view

Transcripts for NAGLU Gene

mRNA/cDNA for NAGLU Gene

Unigene Clusters for NAGLU Gene

N-acetylglucosaminidase, alpha:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for NAGLU

Alternative Splicing Database (ASD) splice patterns (SP) for NAGLU Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b ^ 6a · 6b · 6c
SP3: -

Relevant External Links for NAGLU Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for NAGLU Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for NAGLU Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for NAGLU Gene

This gene is overexpressed in Urine (46.5) and Serum (8.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for NAGLU Gene

Protein tissue co-expression partners for NAGLU Gene

NURSA nuclear receptor signaling pathways regulating expression of NAGLU Gene:


SOURCE GeneReport for Unigene cluster for NAGLU Gene:


mRNA Expression by UniProt/SwissProt for NAGLU Gene:

Tissue specificity: Liver, ovary, peripheral blood leukocytes, testis, prostate, spleen, colon, lung, placenta and kidney.

Evidence on tissue expression from TISSUES for NAGLU Gene

  • Liver(4.4)
  • Skin(4.3)
  • Nervous system(2.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for NAGLU Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • lymphatic
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • ear
  • face
  • forehead
  • head
  • jaw
  • larynx
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • pharynx
  • skull
  • chest wall
  • clavicle
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • trachea
  • intestine
  • kidney
  • large intestine
  • liver
  • small intestine
  • spleen
  • pelvis
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • hair
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with NAGLU: view

No data available for mRNA differential expression in normal tissues for NAGLU Gene

Orthologs for NAGLU Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for NAGLU Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia NAGLU 35 34
  • 99.69 (n)
(Canis familiaris)
Mammalia NAGLU 35 34
  • 87.34 (n)
(Mus musculus)
Mammalia Naglu 17 35 34
  • 84.17 (n)
(Rattus norvegicus)
Mammalia Naglu 34
  • 84.07 (n)
(Bos Taurus)
Mammalia NAGLU 35 34
  • 82.69 (n)
(Anolis carolinensis)
Reptilia NAGLU 35
  • 60 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia naglu 34
  • 63.41 (n)
Str.3226 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.21322 34
(Danio rerio)
Actinopterygii naglu 35 34
  • 62.08 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG13397 35 34
  • 51.87 (n)
ESTS:172F5T 36
  • 41 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP011750 34
  • 51.15 (n)
(Caenorhabditis elegans)
Secernentea K09E4.4 35 36
  • 32 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons CYL1 34
  • 49.45 (n)
Species where no ortholog for NAGLU was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for NAGLU Gene

Gene Tree for NAGLU (if available)
Gene Tree for NAGLU (if available)
Evolutionary constrained regions (ECRs) for NAGLU: view image

Paralogs for NAGLU Gene

(1) SIMAP similar genes for NAGLU Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with NAGLU: view

No data available for Paralogs for NAGLU Gene

Variants for NAGLU Gene

Sequence variations from dbSNP and Humsavar for NAGLU Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1013345784 likely-pathogenic, Mucopolysaccharidosis, MPS-III-B 42,536,274(+) T/C/G genic_upstream_transcript_variant, initiator_codon_variant, missense_variant, upstream_transcript_variant
rs1024697806 likely-benign, Charcot-Marie-Tooth disease, axonal type 2V, Mucopolysaccharidosis, MPS-III-B 42,536,278(+) GGCGGTGGCGGTGGC/GGCGGTGGCGGTGGCGGTGGC coding_sequence_variant, genic_upstream_transcript_variant, inframe_insertion, upstream_transcript_variant
rs104894590 pathogenic-likely-pathogenic, pathogenic, Mucopolysaccharidosis, MPS-III-B, not provided, Mucopolysaccharidosis 3B (MPS3B) [MIM:252920] 42,544,027(+) G/A/T coding_sequence_variant, missense_variant
rs104894591 pathogenic, Mucopolysaccharidosis, MPS-III-B, not provided 42,543,882(+) C/G/T coding_sequence_variant, missense_variant, stop_gained
rs104894592 pathogenic, pathogenic-likely-pathogenic, Mucopolysaccharidosis, MPS-III-B, Sanfilippo syndrome, not provided 42,541,074(+) C/T coding_sequence_variant, intron_variant, stop_gained

Structural Variations from Database of Genomic Variants (DGV) for NAGLU Gene

Variant ID Type Subtype PubMed ID
esv30001 CNV loss 17803354
esv33998 OTHER inversion 15654335
nsv1064012 CNV gain 25217958
nsv1146669 OTHER inversion 26484159

Variation tolerance for NAGLU Gene

Residual Variation Intolerance Score: 13.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.29; 53.11% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for NAGLU Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
Human Gene Mutation Database (HGMD)

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for NAGLU Gene

Disorders for NAGLU Gene

MalaCards: The human disease database

(30) MalaCards diseases for NAGLU Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search NAGLU in MalaCards View complete list of genes associated with diseases


  • Mucopolysaccharidosis 3B (MPS3B) [MIM:252920]: A form of mucopolysaccharidosis type 3, an autosomal recessive lysosomal storage disease due to impaired degradation of heparan sulfate. MPS3 is characterized by severe central nervous system degeneration, but only mild somatic disease. Onset of clinical features usually occurs between 2 and 6 years; severe neurologic degeneration occurs in most patients between 6 and 10 years of age, and death occurs typically during the second or third decade of life. {ECO:0000269 PubMed:10094189, ECO:0000269 PubMed:11068184, ECO:0000269 PubMed:11153910, ECO:0000269 PubMed:11286389, ECO:0000269 PubMed:11793481, ECO:0000269 PubMed:11836372, ECO:0000269 PubMed:12202988, ECO:0000269 PubMed:14984474, ECO:0000269 PubMed:15933803, ECO:0000269 PubMed:16151907, ECO:0000269 PubMed:28101780, ECO:0000269 PubMed:9443875, ECO:0000269 PubMed:9443878, ECO:0000269 PubMed:9832037, ECO:0000269 PubMed:9950362}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Charcot-Marie-Tooth disease 2V (CMT2V) [MIM:616491]: An axonal form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Neuropathies of the CMT2 group are characterized by signs of axonal degeneration in the absence of obvious myelin alterations, normal or slightly reduced nerve conduction velocities, and progressive distal muscle weakness and atrophy. CMT2V is an autosomal dominant sensory neuropathy with late onset. The main clinical feature is recurrent leg pain that progresses to constant painful paraesthesias in the feet and later the hands. As it evolves, some patients develop a mild sensory ataxia. {ECO:0000269 PubMed:25818867}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for NAGLU

genes like me logo Genes that share disorders with NAGLU: view

No data available for Genatlas for NAGLU Gene

Publications for NAGLU Gene

  1. Sanfilippo syndrome in Turkey: Identification of novel mutations in subtypes A and B. (PMID: 11793481) Emre S … Hopwood JJ (Human mutation 2002) 3 4 23 58
  2. Mucopolysaccharidosis type IIIB: characterisation and expression of wild-type and mutant recombinant alpha-N-acetylglucosaminidase and relationship with sanfilippo phenotype in an attenuated patient. (PMID: 11068184) Yogalingam G … Hopwood JJ (Biochimica et biophysica acta 2000) 3 4 23 58
  3. Sanfilippo type B syndrome (mucopolysaccharidosis III B): allelic heterogeneity corresponds to the wide spectrum of clinical phenotypes. (PMID: 10094189) Weber B … Hopwood JJ (European journal of human genetics : EJHG 1999) 3 4 23 58
  4. NAGLU mutations underlying Sanfilippo syndrome type B. (PMID: 9443878) Schmidtchen A … Neufeld EF (American journal of human genetics 1998) 3 4 23 58
  5. Cloning and expression of the gene involved in Sanfilippo B syndrome (mucopolysaccharidosis III B). (PMID: 8776591) Weber B … Hopwood JJ (Human molecular genetics 1996) 3 4 23 58

Products for NAGLU Gene

Sources for NAGLU Gene

Loading form....