Free for academic non-profit institutions. Other users need a Commercial license

MYD88 Gene(Protein Coding)

Myeloid Differentiation Primary Response 88

GCID:
GC03P038179
GIFtS:
57
Genes Participants
UDN Logo

Aliases for MYD88 Gene

Aliases for MYD88 Gene

  • Myeloid Differentiation Primary Response 88 2 3 5
  • Myeloid Differentiation Primary Response Gene (88) 2 3
  • Myeloid Differentiation Primary Response Protein MyD88 3
  • Mutant Myeloid Differentiation Primary Response 88 3
  • MYD88D 3

External Ids for MYD88 Gene

Previous GeneCards Identifiers for MYD88 Gene

  • GC03P037467
  • GC03M038006
  • GC03P037993
  • GC03P038140
  • GC03P038155

Summaries for MYD88 Gene

Entrez Gene Summary for MYD88 Gene

  • This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]

CIViC summary for MYD88 Gene

GeneCards Summary for MYD88 Gene

MYD88 (Myeloid Differentiation Primary Response 88) is a Protein Coding gene. Diseases associated with MYD88 include Myd88 Deficiency and Waldenstrom Macroglobulinemia. Among its related pathways are Activated TLR4 signalling and Bacterial infections in CF airways. Gene Ontology (GO) annotations related to this gene include identical protein binding and death receptor binding.

UniProtKB/Swiss-Prot for MYD88 Gene

  • Adapter protein involved in the Toll-like receptor and IL-1 receptor signaling pathway in the innate immune response (PubMed:15361868, PubMed:18292575). Acts via IRAK1, IRAK2, IRF7 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response (PubMed:15361868, PubMed:24316379, PubMed:19506249). Increases IL-8 transcription (PubMed:9013863). Involved in IL-18-mediated signaling pathway. Activates IRF1 resulting in its rapid migration into the nucleus to mediate an efficient induction of IFN-beta, NOS2/INOS, and IL12A genes. MyD88-mediated signaling in intestinal epithelial cells is crucial for maintenance of gut homeostasis and controls the expression of the antimicrobial lectin REG3G in the small intestine (By similarity).

Gene Wiki entry for MYD88 Gene

Additional gene information for MYD88 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MYD88 Gene

Genomics for MYD88 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for MYD88 Gene

Promoters and enhancers for MYD88 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH03J038129 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 650.7 -3.9 -3903 10.9 HDGF PKNOX1 FOXA2 SMAD1 MLX ARNT ARID4B SIN3A DMAP1 YY1 ACAA1 MYD88 OXSR1 PIR37756 ENSG00000201965 GC03M038125
GH03J038163 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 19.3 +28.7 28720 8 MLX ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 OXSR1 LOC101928234 GORASP1 C3orf35 ACAA1 MYD88 SLC22A13 ACVR2B-AS1 VILL PLCD1
GH03J038150 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 12.9 +14.6 14635 5 HDAC1 ZNF335 FOS ATF7 RUNX3 PHF21A NFYC CEBPB REST GATAD2B VILL MYD88 OXSR1 ACAA1
GH03J038102 Enhancer 0.6 FANTOM5 Ensembl 13.9 -36.0 -36026 0.9 HDAC2 KDM1A MYD88 VILL ACAA1 SLC22A13 PLCD1 OXSR1 SLC22A14 PIR60395 GC03M038048 DLEC1
GH03J038227 Enhancer 0.7 Ensembl ENCODE 11.2 +89.6 89553 1.1 JUN SCRT2 CEBPB CEBPG ACAA1 MYD88 GC03P038253 PIR62277 LOC101928234 OXSR1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MYD88 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MYD88 gene promoter:
  • STAT3
  • AP-1
  • IRF-1
  • ATF-2
  • c-Jun
  • c-Fos

Genomic Locations for MYD88 Gene

Genomic Locations for MYD88 Gene
chr3:38,138,478-38,143,022
(GRCh38/hg38)
Size:
4,545 bases
Orientation:
Plus strand
chr3:38,179,969-38,184,513
(GRCh37/hg19)
Size:
4,545 bases
Orientation:
Plus strand

Genomic View for MYD88 Gene

Genes around MYD88 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MYD88 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MYD88 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for MYD88 Gene

Proteins for MYD88 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for MYD88 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q99836-MYD88_HUMAN
    Recommended name:
    Myeloid differentiation primary response protein MyD88
    Protein Accession:
    Q99836
    Secondary Accessions:
    • B4DKH8
    • B4DKU4
    • B4DQ60
    • B4DQ72
    • J3KPU4
    • J3KQ87
    • J3KQJ6
    • P78397
    • Q53XS7

    Protein attributes for MYD88 Gene

    Size:
    296 amino acids
    Molecular mass:
    33233 Da
    Quaternary structure:
    • Homodimer. Also forms heterodimers with TIRAP. Binds to TLR2, TLR4, IRAK1, IRAK2 and IRAK4 via their respective TIR domains. Interacts with IL18R1. Interacts with BMX, IL1RL1, IKBKE and IRF7. Interacts with LRRFIP1 and LRRFIP2; this interaction positively regulates Toll-like receptor (TLR) signaling in response to agonist. Interacts with FLII. LRRFIP1 and LRRFIP2 compete with FLII for MYD88-binding. Interacts with IRF1. Upon IL1B treatment, forms a complex with PELI1, IRAK1, IRAK4 and TRAF6; this complex recruits MAP3K7/TAK1, TAB1 and TAB2 to mediate NF-kappa-B activation. Direct binding of SMAD6 to PELI1 prevents the complex formation and hence negatively regulates IL1R-TLR signaling and eventually NF-kappa-B-mediated gene expression. May interact with PIK3AP1. Interacts (via TIR domain) with DHX9 (via H2A and OB-fold regions); this interaction is direct (PubMed:20696886). Interacts with OTUD4 deubiquitinase; the interaction is direct (PubMed:29395066).
    SequenceCaution:
    • Sequence=BAG60822.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=BAG60834.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=EAW64521.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for MYD88 Gene

    Alternative splice isoforms for MYD88 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MYD88 Gene

Protein Expression for MYD88 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for MYD88 Gene

  • Ubiquitinated; undergoes Lys-63-linked polyubiquitination. OTUD4 specifically hydrolyzes Lys-63-linked polyubiquitinated MYD88.
  • Ubiquitination at Lys282, isoforms=2, 5, 6231, isoforms=3, 5, 6119, and Lys95
  • Modification sites at PhosphoSitePlus

Other Protein References for MYD88 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for MYD88

No data available for DME Specific Peptides for MYD88 Gene

Domains & Families for MYD88 Gene

Gene Families for MYD88 Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for MYD88 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for MYD88 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q99836

UniProtKB/Swiss-Prot:

MYD88_HUMAN :
  • The intermediate domain (ID) is required for the phosphorylation and activation of IRAK.
Domain:
  • The intermediate domain (ID) is required for the phosphorylation and activation of IRAK.
genes like me logo Genes that share domains with MYD88: view

Function for MYD88 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for MYD88 Gene

UniProtKB/Swiss-Prot Function:
Adapter protein involved in the Toll-like receptor and IL-1 receptor signaling pathway in the innate immune response (PubMed:15361868, PubMed:18292575). Acts via IRAK1, IRAK2, IRF7 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response (PubMed:15361868, PubMed:24316379, PubMed:19506249). Increases IL-8 transcription (PubMed:9013863). Involved in IL-18-mediated signaling pathway. Activates IRF1 resulting in its rapid migration into the nucleus to mediate an efficient induction of IFN-beta, NOS2/INOS, and IL12A genes. MyD88-mediated signaling in intestinal epithelial cells is crucial for maintenance of gut homeostasis and controls the expression of the antimicrobial lectin REG3G in the small intestine (By similarity).
GENATLAS Biochemistry:
myeloid differentiation primary response gene,88,binding the cytoplasmic tail of TLR proteins leading to their activation,initiating an intracellular signaling pathway to NFKB and its target genes

Gene Ontology (GO) - Molecular Function for MYD88 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 signaling receptor binding IEA --
GO:0005121 Toll binding IEA --
GO:0005123 death receptor binding TAS 9374458
GO:0005149 interleukin-1 receptor binding IEA --
GO:0005515 protein binding IEA,IPI 10383454
genes like me logo Genes that share ontologies with MYD88: view
genes like me logo Genes that share phenotypes with MYD88: view

Human Phenotype Ontology for MYD88 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for MYD88 Gene

MGI Knock Outs for MYD88:

Animal Model Products

Clone Products

  • Addgene plasmids for MYD88

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for MYD88 Gene

Localization for MYD88 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MYD88 Gene

Cytoplasm. Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MYD88 gene
Compartment Confidence
plasma membrane 5
nucleus 5
cytosol 5
endosome 5
extracellular 3
lysosome 2
cytoskeleton 1
mitochondrion 1
peroxisome 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Mitochondria (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for MYD88 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA 22155231
GO:0005737 cytoplasm IDA,IEA 22155231
GO:0005829 cytosol IEA,TAS --
GO:0005886 plasma membrane IEA,TAS --
GO:0010008 endosome membrane TAS --
genes like me logo Genes that share ontologies with MYD88: view

Pathways & Interactions for MYD88 Gene

SuperPathways for MYD88 Gene

PathCards logo More details on SuperPathways for MYD88
SuperPathway Contained pathways
1 Activated TLR4 signalling
Toll Like Receptor 9 (TLR9) Cascade
.94
TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
.94
Activated TLR4 signalling
.91
Toll Like Receptor 4 (TLR4) Cascade
.91
MyD88 cascade initiated on plasma membrane
.88
Toll Like Receptor 10 (TLR10) Cascade
.88
Toll Like Receptor 5 (TLR5) Cascade
.88
MyD88 dependent cascade initiated on endosome
.86
Toll Like Receptor 7/8 (TLR7/8) Cascade
.86
MyD88-independent TLR3/TLR4 cascade
.86
Toll Like Receptor 3 (TLR3) Cascade
.86
TRIF-mediated TLR3/TLR4 signaling
.86
MyD88-Mal cascade initiated on plasma membrane
.85
Toll Like Receptor 2 (TLR2) Cascade
.85
Toll Like Receptor TLR1-TLR2 Cascade
.85
Toll Like Receptor TLR6-TLR2 Cascade
.85
Toll-Like Receptors Cascades
.82
TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
.01
2 Diseases associated with the TLR signaling cascade
Diseases associated with the TLR signaling cascade
.46
Diseases of Immune System
.46
MyD88 deficiency (TLR2/4)
.46
Toll-like Receptor Signaling
.44
TLR4 Signaling and Tolerance
.38
Simplified Depiction of MYD88 Distinct Input-Output Pathway
.34
IRAK4 deficiency (TLR2/4)
.01
IRAK4 deficiency (TLR5)
.01
MyD88 deficiency (TLR5)
.01
3 Cytosolic sensors of pathogen-associated DNA
RIP-mediated NFkB activation via ZBP1
.84
ZBP1(DAI) mediated induction of type I IFNs
.84
TRAF6 mediated NF-kB activation
.53
TAK1 activates NFkB by phosphorylation and activation of IKKs complex
.47
Cytosolic sensors of pathogen-associated DNA
.36
DEx/H-box helicases activate type I IFN and inflammatory cytokines production
.01
4 Toll-like Receptor Signaling Pathway
Toll-like receptor signaling pathway
.92
Toll-like Receptor Signaling Pathway
.92
Regulation of toll-like receptor signaling pathway
.71
Chagas disease (American trypanosomiasis)
.31
NOD-like receptor signaling pathway
.31
5 Toll Comparative Pathway
TLR-TRIF Pathway
.61
Toll Comparative Pathway
.61
Immune response MIF in innate immunity response
.46
IL-1 Pathway
.39
iNOS Signaling
.34
genes like me logo Genes that share pathways with MYD88: view

SIGNOR curated interactions for MYD88 Gene

Activates:
Is activated by:

Gene Ontology (GO) - Biological Process for MYD88 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002224 toll-like receptor signaling pathway TAS --
GO:0002238 response to molecule of fungal origin IEA --
GO:0002376 immune system process IEA --
GO:0002755 MyD88-dependent toll-like receptor signaling pathway TAS,IEA --
GO:0006915 apoptotic process IMP 22155231
genes like me logo Genes that share ontologies with MYD88: view

Drugs & Compounds for MYD88 Gene

Products:

  1. Drug

(12) Drugs for MYD88 Gene - From: PharmGKB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Fentanyl Approved, Illicit, Investigational, Vet_approved Pharma Full agonist, Agonist, Partial agonist 894
ST 2825 Pharma Inhibitor of MyD88 dimerization 0

(11) Additional Compounds for MYD88 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with MYD88: view

Transcripts for MYD88 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for MYD88 Gene

(7) REFSEQ mRNAs :
(14) Additional mRNA sequences :
(260) Selected AceView cDNA sequences:
(11) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for MYD88 Gene

Myeloid differentiation primary response 88:
Representative Sequences:

Clone Products

  • Addgene plasmids for MYD88

Alternative Splicing Database (ASD) splice patterns (SP) for MYD88 Gene

ExUns: 1a · 1b · 1c ^ 2a · 2b · 2c ^ 3a · 3b · 3c ^ 4a · 4b · 4c ^ 5a · 5b · 5c
SP1: - - -
SP2: - -
SP3: - - - -
SP4: - - -
SP5: - - - - - -
SP6: - - - -
SP7: - - - - -
SP8: -
SP9:

Relevant External Links for MYD88 Gene

GeneLoc Exon Structure for
MYD88
ECgene alternative splicing isoforms for
MYD88

Expression for MYD88 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MYD88 Gene

mRNA expression in normal human tissues for MYD88 Gene
mRNA expression by BioGPS for MYD88 GenemRNA expression by GTEx for MYD88 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for MYD88 Gene

This gene is overexpressed in Whole Blood (x17.2).

Protein differential expression in normal tissues from HIPED for MYD88 Gene

This gene is overexpressed in Monocytes (13.1), Peripheral blood mononuclear cells (10.3), and Lymph node (8.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for MYD88 Gene



Protein tissue co-expression partners for MYD88 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MYD88 Gene:

MYD88

SOURCE GeneReport for Unigene cluster for MYD88 Gene:

Hs.82116

mRNA Expression by UniProt/SwissProt for MYD88 Gene:

Q99836-MYD88_HUMAN
Tissue specificity: Ubiquitous.

Evidence on tissue expression from TISSUES for MYD88 Gene

  • Blood(4.9)
  • Spleen(4.8)
  • Lymph node(4.7)
  • Pancreas(4.4)
  • Nervous system(4.3)
  • Lung(3.6)
  • Intestine(3.5)
  • Liver(3.2)
  • Bone marrow(3.1)
  • Kidney(3.1)
  • Heart(2.9)
  • Skin(2.8)
  • Muscle(2.6)
  • Stomach(2.6)

Phenotype-based relationships between genes and organs from Gene ORGANizer for MYD88 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • respiratory
  • skeleton
Regions:
Head and neck:
  • brain
  • ear
  • head
  • mouth
  • sinus
  • skull
Thorax:
  • lung
General:
  • blood
  • blood vessel
  • bone marrow
  • coagulation system
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with MYD88: view

Orthologs for MYD88 Gene

This gene was present in the common ancestor of animals.

Orthologs for MYD88 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia MYD88 34 33
  • 99.21 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia MYD88 34 33
  • 89.64 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia MYD88 34 33
  • 86.15 (n)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia MYD88 34
  • 86 (a)
 OneToOne
mouse
(Mus musculus)
 Mammalia Myd88 16 34 33
  • 82.37 (n)
rat
(Rattus norvegicus)
 Mammalia Myd88 33
  • 81.29 (n)
chicken
(Gallus gallus)
 Aves MYD88 34 33
  • 71.45 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia MYD88 34
  • 63 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia myd88 33
  • 66.54 (n)
Str.11893 33
African clawed frog
(Xenopus laevis)
 Amphibia myd88-A 33
zebrafish
(Danio rerio)
 Actinopterygii myd88 34 33
  • 63.02 (n)
 OneToOne
African malaria mosquito
(Anopheles gambiae)
 Insecta MYD 33
  • 44.86 (n)
fruit fly
(Drosophila melanogaster)
 Insecta Myd88 34
  • 15 (a)
 OneToOne
sea squirt
(Ciona savignyi)
 Ascidiacea CSA.2481 34
  • 19 (a)
 OneToOne
Species where no ortholog for MYD88 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MYD88 Gene

ENSEMBL:
Gene Tree for MYD88 (if available)
TreeFam:
Gene Tree for MYD88 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MYD88: view image

Paralogs for MYD88 Gene

No data available for Paralogs for MYD88 Gene

Variants for MYD88 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for MYD88 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs137853064 pathogenic, Myd88 deficiency 38,140,510(+) C/A/T coding_sequence_variant, intron_variant, missense_variant
rs137853065 pathogenic, Myd88 deficiency 38,138,978(+) T/C coding_sequence_variant, missense_variant
rs191826554 benign, Myd88 deficiency 38,140,528(+) A/C coding_sequence_variant, intron_variant, missense_variant
rs387907272 pathogenic, likely-pathogenic, Macroglobulinemia, waldenstrom, somatic, Lymphoma, Chronic lymphocytic leukemia, Multiple myeloma, Malignant lymphoma, non-Hodgkin 38,141,150(+) T/C coding_sequence_variant, missense_variant, stop_lost, terminator_codon_variant
rs746651350 pathogenic, Myd88 deficiency 38,138,671(+) GACCGCGCTGAGGCTCCAGGACCGC/GACCGC coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for MYD88 Gene

Variant ID Type Subtype PubMed ID
esv3359602 CNV duplication 20981092

Variation tolerance for MYD88 Gene

Residual Variation Intolerance Score: 30.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.85; 17.74% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MYD88 Gene

Human Gene Mutation Database (HGMD)
MYD88
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MYD88

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MYD88 Gene

Disorders for MYD88 Gene

MalaCards: The human disease database

(27) MalaCards diseases for MYD88 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
myd88 deficiency
  • myd88d
waldenstrom macroglobulinemia
  • lymphoplasmacytic lymphoma
macroglobulinemia
  • waldenstrom macroglobulinemia
central nervous system lymphoma
  • microglioma
primary central nervous system lymphoma
  • primary cns lymphoma
- elite association - COSMIC cancer census association via MalaCards
Search MYD88 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

MYD88_HUMAN
  • MYD88 deficiency (MYD88D) [MIM:612260]: Patients suffer from autosomal recessive, life-threatening, often recurrent pyogenic bacterial infections, including invasive pneumococcal disease, and die between 1 and 11 months of age. Surviving patients are otherwise healthy, with normal resistance to other microbes, and their clinical status improved with age. {ECO:0000269 PubMed:18669862, ECO:0000269 PubMed:19506249, ECO:0000269 PubMed:21057262, ECO:0000269 PubMed:24316379}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Note=Defects in MYD88 are frequently found in many hematological malignancies, such as activated B-cell type diffuse large B-cell lymphoma (ABC-DLBCL), Waldenstroems macroglobulinemia, cutaneous diffuse large B cell lymphoma (CBCL) and primary central nervous system lymphoma (PCNSL). {ECO:0000269 PubMed:21179087, ECO:0000269 PubMed:22931316}.

Additional Disease Information for MYD88

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MYD88: view

No data available for Genatlas for MYD88 Gene

Publications for MYD88 Gene

  1. Modulation of TLR signaling by multiple MyD88-interacting partners including leucine-rich repeat Fli-I-interacting proteins. (PMID: 19265123) Dai P … Chen X (Journal of immunology (Baltimore, Md. : 1950) 2009) 3 4 22 58
  2. Structural basis for the multiple interactions of the MyD88 TIR domain in TLR4 signaling. (PMID: 19506249) Ohnishi H … Shirakawa M (Proceedings of the National Academy of Sciences of the United States of America 2009) 3 4 22 58
  3. Etk/BMX, a Btk family tyrosine kinase, and Mal contribute to the cross-talk between MyD88 and FAK pathways. (PMID: 18292575) Semaan N … Sibilia J (Journal of immunology (Baltimore, Md. : 1950) 2008) 3 4 22 58
  4. Interferon-alpha induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. (PMID: 15361868) Kawai T … Akira S (Nature immunology 2004) 3 4 22 58
  5. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. (PMID: 9013863) Bonnert TP … Sims JE (FEBS letters 1997) 2 3 4 58

Products for MYD88 Gene

  • Addgene plasmids for MYD88

Sources for MYD88 Gene

Content
Loading form....