Aliases for MVB12A Gene

Aliases for MVB12A Gene

  • Multivesicular Body Subunit 12A 2 3 4 5
  • Family With Sequence Similarity 125, Member A 2 3
  • ESCRT-I Complex Subunit MVB12A 3 4
  • FAM125A 3 4
  • CFBP 3 4
  • CIN85/CD2AP Family Binding Protein 3
  • CIN85/CD2AP Family-Binding Protein 4
  • Protein FAM125A 4

External Ids for MVB12A Gene

Previous HGNC Symbols for MVB12A Gene

  • FAM125A

Previous GeneCards Identifiers for MVB12A Gene

  • GC19P017518
  • GC19P017605
  • GC19P017913
  • GC19P017558
  • GC19P017707
  • GC19P020536
  • GC19P020684
  • GC19P017728
  • GC19P018349
  • GC19P018732
  • GC19P019044
  • GC19P019361
  • GC19P019696
  • GC19P020072
  • GC19P020398

Summaries for MVB12A Gene

GeneCards Summary for MVB12A Gene

MVB12A (Multivesicular Body Subunit 12A) is a Protein Coding gene. Among its related pathways are Endocytosis. Gene Ontology (GO) annotations related to this gene include lipid binding and ubiquitin binding.

UniProtKB/Swiss-Prot Summary for MVB12A Gene

  • Component of the ESCRT-I complex, a regulator of vesicular trafficking process. Required for the sorting of endocytic ubiquitinated cargos into multivesicular bodies. May be involved in the ligand-mediated internalization and down-regulation of EGF receptor.

Additional gene information for MVB12A Gene

No data available for Entrez Gene Summary , CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for MVB12A Gene

Genomics for MVB12A Gene

GeneHancer (GH) Regulatory Elements for MVB12A Gene

Promoters and enhancers for MVB12A Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MVB12A on UCSC Golden Path with GeneCards custom track

Genomic Locations for MVB12A Gene

Genomic Locations for MVB12A Gene
28,039 bases
Plus strand
28,003 bases
Plus strand

Genomic View for MVB12A Gene

Genes around MVB12A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MVB12A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MVB12A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MVB12A Gene

Proteins for MVB12A Gene

  • Protein details for MVB12A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Multivesicular body subunit 12A
    Protein Accession:
    Secondary Accessions:
    • Q96I18

    Protein attributes for MVB12A Gene

    273 amino acids
    Molecular mass:
    28783 Da
    Quaternary structure:
    • Component of the ESCRT-I complex (endosomal sorting complex required for transport I) which consists of TSG101, VPS28, a VPS37 protein (VPS37A to -D) and MVB12A or MVB12B in a 1:1:1:1 stoichiometry. Interacts with CD2AP and CIN85/SH3KBP1. Interacts with CD2AP (via one of the SH3 domains). Interacts with TSG101; the association appears to be mediated by the TSG101-VPS37 binary subcomplex. Interacts with VPS28. Interacts with VPS37B; the association appears to be mediated by the TSG101-VPS37 binary subcomplex. Interacts with VPS37C; the association appears to be mediated by the TSG101-VPS37 binary subcomplex. Interacts with VPS37D; the association appears to be mediated by the TSG101-VPS37 binary subcomplex. Interacts with CEP55.

    Alternative splice isoforms for MVB12A Gene


neXtProt entry for MVB12A Gene

Post-translational modifications for MVB12A Gene

  • Phosphorylated on Tyr-204 upon EGF stimulation. Phosphorylation is required for interaction with CD2AP and CIN85/SH3KBP1.
  • Ubiquitination at Lys179
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for MVB12A Gene

Domains & Families for MVB12A Gene

Gene Families for MVB12A Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for MVB12A Gene


Suggested Antigen Peptide Sequences for MVB12A Gene

GenScript: Design optimal peptide antigens:
  • Protein FAM125A (F125A_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the MVB12 family.
  • Belongs to the MVB12 family.
genes like me logo Genes that share domains with MVB12A: view

Function for MVB12A Gene

Molecular function for MVB12A Gene

UniProtKB/Swiss-Prot Function:
Component of the ESCRT-I complex, a regulator of vesicular trafficking process. Required for the sorting of endocytic ubiquitinated cargos into multivesicular bodies. May be involved in the ligand-mediated internalization and down-regulation of EGF receptor.

Phenotypes From GWAS Catalog for MVB12A Gene

Gene Ontology (GO) - Molecular Function for MVB12A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 18005716
GO:0008289 lipid binding IMP 22232651
GO:0017124 SH3 domain binding IEA --
GO:0043130 ubiquitin binding IMP 20654576
genes like me logo Genes that share ontologies with MVB12A: view

Phenotypes for MVB12A Gene

genes like me logo Genes that share phenotypes with MVB12A: view

Animal Model Products

CRISPR Products

miRNA for MVB12A Gene

miRTarBase miRNAs that target MVB12A

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MVB12A

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MVB12A Gene

Localization for MVB12A Gene

Subcellular locations from UniProtKB/Swiss-Prot for MVB12A Gene

Cytoplasm. Nucleus. Endosome. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Late endosome membrane; Peripheral membrane protein. Note=Colocalizes with F-actin. Some fraction may be nuclear.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MVB12A gene
Compartment Confidence
cytoskeleton 5
nucleus 5
endosome 5
cytosol 5
golgi apparatus 4
extracellular 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (3)
  • Golgi apparatus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for MVB12A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000813 ESCRT I complex TAS 20588296
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IEA --
GO:0005768 endosome IEA --
genes like me logo Genes that share ontologies with MVB12A: view

Pathways & Interactions for MVB12A Gene

PathCards logo

SuperPathways for MVB12A Gene

SuperPathway Contained pathways
1 Endocytosis
genes like me logo Genes that share pathways with MVB12A: view

Pathways by source for MVB12A Gene

1 KEGG pathway for MVB12A Gene

Gene Ontology (GO) - Biological Process for MVB12A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0015031 protein transport IEA --
GO:0016197 endosomal transport TAS --
GO:0016236 macroautophagy TAS 20588296
GO:0019058 viral life cycle TAS --
GO:0019075 virus maturation IMP 18005716
genes like me logo Genes that share ontologies with MVB12A: view

No data available for SIGNOR curated interactions for MVB12A Gene

Drugs & Compounds for MVB12A Gene

No Compound Related Data Available

Transcripts for MVB12A Gene

mRNA/cDNA for MVB12A Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MVB12A

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MVB12A Gene

No ASD Table

Relevant External Links for MVB12A Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MVB12A Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MVB12A Gene

Protein differential expression in normal tissues from HIPED for MVB12A Gene

This gene is overexpressed in Breast (31.1) and Urine (17.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for MVB12A Gene

Protein tissue co-expression partners for MVB12A Gene

NURSA nuclear receptor signaling pathways regulating expression of MVB12A Gene:


SOURCE GeneReport for Unigene cluster for MVB12A Gene:


mRNA Expression by UniProt/SwissProt for MVB12A Gene:

Tissue specificity: Ubiquitously expressed except in skeletal muscle.

Evidence on tissue expression from TISSUES for MVB12A Gene

  • Pancreas(4.2)
  • Nervous system(3)
genes like me logo Genes that share expression patterns with MVB12A: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for MVB12A Gene

Orthologs for MVB12A Gene

This gene was present in the common ancestor of animals.

Orthologs for MVB12A Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia FAM125A 32
  • 99.63 (n)
MVB12A 33
  • 99 (a)
(Canis familiaris)
Mammalia MVB12A 33
  • 90 (a)
FAM125A 32
  • 87.67 (n)
(Bos Taurus)
Mammalia MVB12A 33 32
  • 85.84 (n)
(Mus musculus)
Mammalia Mvb12a 17 33 32
  • 82.53 (n)
(Rattus norvegicus)
Mammalia Mvb12a 32
  • 80.79 (n)
(Monodelphis domestica)
Mammalia MVB12A 33
  • 66 (a)
(Ornithorhynchus anatinus)
Mammalia MVB12A 33
  • 52 (a)
(Gallus gallus)
Aves FAM125A 33 32
  • 58.63 (n)
(Anolis carolinensis)
Reptilia MVB12A 33
  • 55 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia mvb12a 32
  • 53.75 (n)
African clawed frog
(Xenopus laevis)
Amphibia MGC52908 32
(Danio rerio)
Actinopterygii zgc:63691 32
  • 54.13 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG7192 33
  • 17 (a)
(Caenorhabditis elegans)
Secernentea mvb-12 33
  • 18 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10662 33
  • 21 (a)
Species where no ortholog for MVB12A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for MVB12A Gene

Gene Tree for MVB12A (if available)
Gene Tree for MVB12A (if available)
Evolutionary constrained regions (ECRs) for MVB12A: view image

Paralogs for MVB12A Gene

(2) SIMAP similar genes for MVB12A Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with MVB12A: view

No data available for Paralogs for MVB12A Gene

Variants for MVB12A Gene

Sequence variations from dbSNP and Humsavar for MVB12A Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1555734052 association, Human immunodeficiency virus type 1, rapid progression to AIDS 17,406,018(+) GGGCCTG/GGGCCTGAGTCTGGGGGCGGGGCCTG genic_upstream_transcript_variant, intron_variant
rs1000102962 -- 17,425,059(+) C/A/G/T 3_prime_UTR_variant
rs1000157410 -- 17,408,539(+) G/A/T genic_upstream_transcript_variant, intron_variant
rs1000554402 -- 17,424,320(+) G/A intron_variant
rs1000906895 -- 17,406,000(+) C/G/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for MVB12A Gene

Variant ID Type Subtype PubMed ID
nsv833768 CNV loss 17160897

Variation tolerance for MVB12A Gene

Residual Variation Intolerance Score: 77.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.98; 49.63% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MVB12A Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MVB12A Gene

Disorders for MVB12A Gene

Additional Disease Information for MVB12A

No disorders were found for MVB12A Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MVB12A Gene

Publications for MVB12A Gene

  1. Identification of human MVB12 proteins as ESCRT-I subunits that function in HIV budding. (PMID: 18005716) Morita E … Sundquist WI (Cell host & microbe 2007) 2 3 4 56
  2. Structural basis for membrane targeting by the MVB12-associated β-prism domain of the human ESCRT-I MVB12 subunit. (PMID: 22232651) Boura E … Hurley JH (Proceedings of the National Academy of Sciences of the United States of America 2012) 2 3 56
  3. Distinct functions of human MVB12A and MVB12B in the ESCRT-I dependent on their posttranslational modifications. (PMID: 20654576) Tsunematsu T … Konishi H (Biochemical and biophysical research communications 2010) 2 3 56
  4. Human ESCRT and ALIX proteins interact with proteins of the midbody and function in cytokinesis. (PMID: 17853893) Morita E … Sundquist WI (The EMBO journal 2007) 3 4 56
  5. CFBP is a novel tyrosine-phosphorylated protein that might function as a regulator of CIN85/CD2AP. (PMID: 16895919) Konishi H … Taniguchi H (The Journal of biological chemistry 2006) 3 4 56

Products for MVB12A Gene

Sources for MVB12A Gene