Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MTG2 Gene

Aliases for MTG2 Gene

  • Mitochondrial Ribosome Associated GTPase 2 2 3 5
  • Mitochondrial Ribosome-Associated GTPase 2 2 3
  • GTP Binding Protein 5 (Putative) 2 3
  • Protein Obg Homolog 1 3 4
  • GTP-Binding Protein 5 3 4
  • GTPBP5 3 4
  • ObgH1 3 4
  • GTP-Binding Protein 5 (Putative) 2
  • DJ1005F21.2 3
  • OBGH1 4

External Ids for MTG2 Gene

Previous HGNC Symbols for MTG2 Gene

  • GTPBP5

Previous GeneCards Identifiers for MTG2 Gene

  • GC20P060759

Summaries for MTG2 Gene

Entrez Gene Summary for MTG2 Gene

  • Small G proteins, such as GTPBP5, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).[supplied by OMIM, Mar 2008]

GeneCards Summary for MTG2 Gene

MTG2 (Mitochondrial Ribosome Associated GTPase 2) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include GTP binding and magnesium ion binding. An important paralog of this gene is GTPBP10.

UniProtKB/Swiss-Prot for MTG2 Gene

  • Plays a role in the regulation of the mitochondrial ribosome assembly and of translational activity. Displays GTPase activity. Involved in the ribosome maturation process.

Additional gene information for MTG2 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MTG2 Gene

Genomics for MTG2 Gene

GeneHancer (GH) Regulatory Elements for MTG2 Gene

Promoters and enhancers for MTG2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20J062181 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 655.6 +0.3 251 3 HDGF PKNOX1 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 POLR2B E2F8 MTG2 DIDO1 RPS21 MRGBP TAF4 LAMA5 LSM14B SS18L1 CABLES2 GATA5
GH20J062352 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 9 +179.1 179090 19.1 CLOCK MLX ZFP64 DMAP1 YY1 ZNF263 SP3 NFYC SSRP1 GLIS1 LAMA5 DIDO1 LAMA5-AS1 ARFGAP1 YTHDF1 TAF4 MTG2 CABLES2 OSBPL2 BHLHE23
GH20J062140 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 8.7 -40.1 -40120 4.3 PKNOX1 ARNT ZFP64 ARID4B SIN3A DMAP1 YY1 POLR2B ZNF766 ZNF207 SS18L1 PIR42263 PSMA7 MRGBP TAF4 DIDO1 ADRM1 MTG2
GH20J062649 Promoter/Enhancer 2.1 FANTOM5 Ensembl ENCODE dbSUPER 10.6 +469.1 469067 4.7 HDGF PKNOX1 CLOCK FOXA2 SMAD1 MLX ARID4B NEUROD1 SIN3A FEZF1 ENSG00000276317 ENSG00000277496 OGFR YTHDF1 OGFR-AS1 MTG2 MIR1-1 MIR1-1HG MIR1-1HG-AS1 DIDO1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MTG2 on UCSC Golden Path with GeneCards custom track

Genomic Locations for MTG2 Gene

Genomic Locations for MTG2 Gene
20,544 bases
Plus strand
20,544 bases
Plus strand

Genomic View for MTG2 Gene

Genes around MTG2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MTG2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MTG2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MTG2 Gene

Proteins for MTG2 Gene

  • Protein details for MTG2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Mitochondrial ribosome-associated GTPase 2
    Protein Accession:
    Secondary Accessions:
    • A6NDR3
    • B4DR85
    • Q96I17
    • Q9NVG9
    • Q9UFR4

    Protein attributes for MTG2 Gene

    406 amino acids
    Molecular mass:
    43955 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Associates with the mitochondrial ribosome large subunit; the association occurs in a GTP-dependent manner.
    • Sequence=BAA91783.1; Type=Erroneous termination; Positions=402; Note=Translated as Gln.; Evidence={ECO:0000305};

    Alternative splice isoforms for MTG2 Gene


neXtProt entry for MTG2 Gene

Post-translational modifications for MTG2 Gene

  • Ubiquitination at isoforms=123
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for MTG2 Gene

Domains & Families for MTG2 Gene

Gene Families for MTG2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TRAFAC class OBG-HflX-like GTPase superfamily. OBG GTPase family.
  • Belongs to the TRAFAC class OBG-HflX-like GTPase superfamily. OBG GTPase family.
genes like me logo Genes that share domains with MTG2: view

Function for MTG2 Gene

Molecular function for MTG2 Gene

UniProtKB/Swiss-Prot Function:
Plays a role in the regulation of the mitochondrial ribosome assembly and of translational activity. Displays GTPase activity. Involved in the ribosome maturation process.

Phenotypes From GWAS Catalog for MTG2 Gene

Gene Ontology (GO) - Molecular Function for MTG2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000287 magnesium ion binding IEA --
GO:0003924 GTPase activity IDA 23396448
GO:0005525 GTP binding IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with MTG2: view
genes like me logo Genes that share phenotypes with MTG2: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MTG2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MTG2 Gene

Localization for MTG2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MTG2 Gene

Mitochondrion. Mitochondrion inner membrane; Peripheral membrane protein; Matrix side.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MTG2 gene
Compartment Confidence
mitochondrion 5
cytosol 2

Gene Ontology (GO) - Cellular Components for MTG2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005743 mitochondrial inner membrane IDA,IEA 23396448
GO:0005759 mitochondrial matrix IDA 23396448
GO:0005761 mitochondrial ribosome IDA 23396448
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with MTG2: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for MTG2 Gene

Pathways & Interactions for MTG2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MTG2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006417 regulation of translation IEA --
GO:0042254 ribosome biogenesis IEA --
GO:0044065 regulation of respiratory system process IMP 23396448
GO:0070129 regulation of mitochondrial translation IMP 23396448
genes like me logo Genes that share ontologies with MTG2: view

No data available for Pathways by source and SIGNOR curated interactions for MTG2 Gene

Drugs & Compounds for MTG2 Gene

(1) Drugs for MTG2 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Guanosine triphosphate Experimental Pharma 0
genes like me logo Genes that share compounds with MTG2: view

Transcripts for MTG2 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MTG2

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MTG2 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8a · 8b ^ 9a · 9b · 9c ^ 10a · 10b · 10c · 10d · 10e ^ 11 ^ 12a · 12b
SP1: - - - - - -
SP2: - - - - - - -
SP3: - - - - - - - - - -
SP4: - - - - - - - -
SP5: - - - - -
SP6: - - - - - -
SP7: - - - - - - -
SP8: - - - - - -
SP9: -
SP10: - - - - - - - - -
SP11: - - -
SP12: - - - - - - - - - -
SP13: - - - - - - - - - - - - - - - -
SP14: - - - -
SP15: - - -

Relevant External Links for MTG2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MTG2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MTG2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for MTG2 Gene

This gene is overexpressed in Lung (22.3), Esophagus (15.0), and Colon (14.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for MTG2 Gene

NURSA nuclear receptor signaling pathways regulating expression of MTG2 Gene:


Evidence on tissue expression from TISSUES for MTG2 Gene

  • Nervous system(4.7)
  • Intestine(4.2)
  • Muscle(4.2)
  • Skin(2.9)
  • Kidney(2.1)
genes like me logo Genes that share expression patterns with MTG2: view

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MTG2 Gene

Orthologs for MTG2 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for MTG2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia GTPBP5 34 33
  • 99.01 (n)
(Canis familiaris)
Mammalia MTG2 34 33
  • 78.95 (n)
(Mus musculus)
Mammalia Mtg2 16 34 33
  • 78.93 (n)
(Rattus norvegicus)
Mammalia Gtpbp5 33
  • 78.49 (n)
(Bos Taurus)
Mammalia GTPBP5 34 33
  • 77.35 (n)
(Monodelphis domestica)
Mammalia MTG2 34
  • 69 (a)
(Ornithorhynchus anatinus)
Mammalia MTG2 34
  • 67 (a)
(Gallus gallus)
Aves GTPBP5 33
  • 64.92 (n)
MTG2 34
  • 62 (a)
(Anolis carolinensis)
Reptilia MTG2 34
  • 63 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia mtg2 33
  • 65.08 (n)
(Danio rerio)
Actinopterygii mtg2 34 33
  • 63.91 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP009702 33
  • 53.11 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG13390 34 33
  • 49.54 (n)
(Caenorhabditis elegans)
Secernentea M01E5.2 34 33
  • 49.84 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes MTG2 34
  • 26 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons EMB269 33
  • 45.1 (n)
(Oryza sativa)
Liliopsida Os07g0669200 33
  • 46.1 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 45 (a)
Species where no ortholog for MTG2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for MTG2 Gene

Gene Tree for MTG2 (if available)
Gene Tree for MTG2 (if available)
Evolutionary constrained regions (ECRs) for MTG2: view image

Paralogs for MTG2 Gene

Paralogs for MTG2 Gene

(1) SIMAP similar genes for MTG2 Gene using alignment to 5 proteins:

  • B4DR85_HUMAN
  • E7EU10_HUMAN
genes like me logo Genes that share paralogs with MTG2: view

Variants for MTG2 Gene

Sequence variations from dbSNP and Humsavar for MTG2 Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs1000278150 -- 62,183,167(+) GAGAGGCCCCGGCCTAGGAGCTGAGAGGCC/GAGAGGCC genic_upstream_transcript_variant, intron_variant
rs1000574003 -- 62,195,414(+) A/G intron_variant
rs1000610753 -- 62,201,606(+) G/A 3_prime_UTR_variant
rs1000635810 -- 62,191,645(+) G/A/C 5_prime_UTR_variant, intron_variant
rs1000770872 -- 62,187,839(+) T/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MTG2 Gene

Variant ID Type Subtype PubMed ID
nsv955149 CNV deletion 24416366
nsv586484 CNV loss 21841781
nsv1160689 CNV deletion 26073780
esv3646285 CNV loss 21293372
esv2665017 CNV deletion 23128226

Variation tolerance for MTG2 Gene

Residual Variation Intolerance Score: 96.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.77; 58.02% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MTG2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MTG2 Gene

Disorders for MTG2 Gene

Additional Disease Information for MTG2

No disorders were found for MTG2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MTG2 Gene

Publications for MTG2 Gene

  1. Human G-proteins, ObgH1 and Mtg1, associate with the large mitochondrial ribosome subunit and are involved in translation and assembly of respiratory complexes. (PMID: 23396448) Kotani T … Takeuchi N (Nucleic acids research 2013) 2 3 4 58
  2. Human small G proteins, ObgH1, and ObgH2, participate in the maintenance of mitochondria and nucleolar architectures. (PMID: 17054726) Hirano Y … Takeyasu K (Genes to cells : devoted to molecular & cellular mechanisms 2006) 2 3 4 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. The DNA sequence and comparative analysis of human chromosome 20. (PMID: 11780052) Deloukas P … Rogers J (Nature 2001) 3 4 58

Products for MTG2 Gene

Sources for MTG2 Gene

Loading form....