Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MROH8 Gene

Aliases for MROH8 Gene

  • Maestro Heat Like Repeat Family Member 8 2 3 5
  • Maestro Heat-Like Repeat-Containing Protein Family Member 8 3 4
  • C20orf131 3 4
  • C20orf132 3 4
  • Maestro Heat-Like Repeat Family Member 8 2
  • Chromosome 20 Open Reading Frame 131 2
  • Chromosome 20 Open Reading Frame 132 2
  • Hypothetical Protein LOC140699 2
  • Protein MROH8 3
  • DJ621N11.3 3
  • DJ621N11.4 3

External Ids for MROH8 Gene

Previous HGNC Symbols for MROH8 Gene

  • C20orf131
  • C20orf132

Previous GeneCards Identifiers for MROH8 Gene

  • GC20M035730

Summaries for MROH8 Gene

Entrez Gene Summary for MROH8 Gene

  • The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

GeneCards Summary for MROH8 Gene

MROH8 (Maestro Heat Like Repeat Family Member 8) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include binding. An important paralog of this gene is MROH7.

Gene Wiki entry for MROH8 Gene

Additional gene information for MROH8 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MROH8 Gene

Genomics for MROH8 Gene

GeneHancer (GH) Regulatory Elements for MROH8 Gene

Promoters and enhancers for MROH8 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20J037177 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 667.4 +0.3 312 3.3 CLOCK ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 RPN2 MROH8 TTI1 RBL1 DSN1 AAR2 CTNNBL1 DLGAP4-AS1
GH20J037516 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.4 -343.0 -343017 13.1 MLX ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 SP3 SSRP1 GLIS1 BLCAP NNAT RALGAPB RBL1 TTI1 LINC00489 ENSG00000201811 SNHG17 SOGA1 LOC100419562
GH20J037093 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 13.8 +84.1 84132 2.9 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ENSG00000269846 RBL1 RPN2 LINC00489 MROH8 ENSG00000232406 TTI1 SOGA1 LOC100419562 NDRG3
GH20J037343 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.4 -167.4 -167427 7.8 PKNOX1 FOXA2 MLX ARID4B SIN3A DMAP1 YY1 SLC30A9 POLR2B ZNF143 SRC GC20M037240 MANBAL TTI1 RPN2 MROH8 RBL1 TLDC2 DSN1 CTNNBL1
GH20J036988 Enhancer 1.3 FANTOM5 Ensembl ENCODE dbSUPER 13.8 +190.3 190305 2.2 MEIS2 ZNF146 YY2 SOX6 JUN KLF17 CBFA2T3 PPARG NFIC ZNF366 MROH8 RPN2 RBL1 SAMHD1 GHRH SLA2 GC20P036985 PIRC104
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MROH8 on UCSC Golden Path with GeneCards custom track

Genomic Locations for MROH8 Gene

Genomic Locations for MROH8 Gene
chr20:37,101,226-37,179,588
(GRCh38/hg38)
Size:
78,363 bases
Orientation:
Minus strand
chr20:35,729,629-35,807,991
(GRCh37/hg19)
Size:
78,363 bases
Orientation:
Minus strand

Genomic View for MROH8 Gene

Genes around MROH8 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MROH8 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MROH8 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MROH8 Gene

Proteins for MROH8 Gene

  • Protein details for MROH8 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9H579-MROH8_HUMAN
    Recommended name:
    Protein MROH8
    Protein Accession:
    Q9H579
    Secondary Accessions:
    • Q5JYQ6

    Protein attributes for MROH8 Gene

    Size:
    483 amino acids
    Molecular mass:
    54816 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAC04162.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=CAI42666.2; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=CAI95719.2; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Alternative splice isoforms for MROH8 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MROH8 Gene

Post-translational modifications for MROH8 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MROH8 Gene

Domains & Families for MROH8 Gene

Gene Families for MROH8 Gene

Protein Domains for MROH8 Gene

InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MROH8: view

No data available for UniProtKB/Swiss-Prot for MROH8 Gene

Function for MROH8 Gene

Phenotypes From GWAS Catalog for MROH8 Gene

genes like me logo Genes that share phenotypes with MROH8: view

Animal Model Products

CRISPR Products

miRNA for MROH8 Gene

miRTarBase miRNAs that target MROH8

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MROH8

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MROH8 Gene

Localization for MROH8 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MROH8 gene
Compartment Confidence
nucleus 2
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for MROH8 Gene

Pathways & Interactions for MROH8 Gene

SuperPathways for MROH8 Gene

No Data Available

Interacting Proteins for MROH8 Gene

Selected Interacting proteins: Q9H579-MROH8_HUMAN for MROH8 Gene via IID

Symbol External ID(s) Details
APP

Gene Ontology (GO) - Biological Process for MROH8 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for MROH8 Gene

Drugs & Compounds for MROH8 Gene

No Compound Related Data Available

Transcripts for MROH8 Gene

mRNA/cDNA for MROH8 Gene

Unigene Clusters for MROH8 Gene

Maestro heat-like repeat family member 8:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MROH8

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MROH8 Gene

No ASD Table

Relevant External Links for MROH8 Gene

GeneLoc Exon Structure for
MROH8
ECgene alternative splicing isoforms for
MROH8

Expression for MROH8 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MROH8 Gene

mRNA differential expression in normal tissues according to GTEx for MROH8 Gene

This gene is overexpressed in Testis (x8.0).

Protein differential expression in normal tissues from HIPED for MROH8 Gene

This gene is overexpressed in Breast (67.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MROH8 Gene



Protein tissue co-expression partners for MROH8 Gene

NURSA nuclear receptor signaling pathways regulating expression of MROH8 Gene:

MROH8

SOURCE GeneReport for Unigene cluster for MROH8 Gene:

Hs.349125
genes like me logo Genes that share expression patterns with MROH8: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MROH8 Gene

Orthologs for MROH8 Gene

This gene was present in the common ancestor of chordates.

Orthologs for MROH8 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MROH8 34 33
  • 99.27 (n)
OneToOne
dog
(Canis familiaris)
Mammalia MROH8 34 33
  • 85.77 (n)
OneToOne
cow
(Bos Taurus)
Mammalia MROH8 34 33
  • 83.37 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Mroh8 33
  • 79.12 (n)
mouse
(Mus musculus)
Mammalia Mroh8 16 34 33
  • 78.2 (n)
oppossum
(Monodelphis domestica)
Mammalia MROH8 34
  • 56 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia MROH8 34
  • 51 (a)
OneToOne
chicken
(Gallus gallus)
Aves LOC770556 33
  • 44.44 (n)
lizard
(Anolis carolinensis)
Reptilia MROH8 34
  • 34 (a)
OneToOne
Species where no ortholog for MROH8 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for MROH8 Gene

ENSEMBL:
Gene Tree for MROH8 (if available)
TreeFam:
Gene Tree for MROH8 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MROH8: view image

Paralogs for MROH8 Gene

Paralogs for MROH8 Gene

(3) SIMAP similar genes for MROH8 Gene using alignment to 9 proteins:

  • MROH8_HUMAN
  • E7ETR9_HUMAN
  • H0Y2W4_HUMAN
  • H0Y3S5_HUMAN
  • H0Y7Y5_HUMAN
  • H7BXD1_HUMAN
  • H7BZY8_HUMAN
  • Q5JYQ9_HUMAN
  • Q5JYR0_HUMAN
genes like me logo Genes that share paralogs with MROH8: view

Variants for MROH8 Gene

Sequence variations from dbSNP and Humsavar for MROH8 Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs1064792904 benign, not specified 37,179,359(-) GGCGCCGCCGGGTGAGGAGTTGCGCGTGG/GGCGCCGCCGGGTGAGGAGTTGCGCGTGGGGCGCCGCCGGGTGAGGAGTTGCGCGTGG coding_sequence_variant, frameshift
rs1000076422 -- 37,176,368(-) C/T intron_variant
rs1000089342 -- 37,148,464(-) G/A intron_variant
rs1000089973 -- 37,104,377(-) AAA/A genic_downstream_transcript_variant, intron_variant
rs1000091599 -- 37,140,621(-) T/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for MROH8 Gene

Variant ID Type Subtype PubMed ID
nsv510487 OTHER sequence alteration 20534489
nsv178626 CNV deletion 16902084
esv3645754 CNV gain 21293372
esv3645750 CNV gain 21293372
esv26419 CNV gain 19812545

Additional Variant Information for MROH8 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MROH8

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MROH8 Gene

Disorders for MROH8 Gene

Additional Disease Information for MROH8

No disorders were found for MROH8 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MROH8 Gene

Publications for MROH8 Gene

  1. The DNA sequence and comparative analysis of human chromosome 20. (PMID: 11780052) Deloukas P … Rogers J (Nature 2001) 2 3 4 58
  2. Nucleolar proteome dynamics. (PMID: 15635413) Andersen JS … Mann M (Nature 2005) 2 3 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  4. FOXA1 Directs H3K4 Monomethylation at Enhancers via Recruitment of the Methyltransferase MLL3. (PMID: 27926873) Jozwik KM … Carroll JS (Cell reports 2016) 3 58
  5. Interactions of pathological hallmark proteins: tubulin polymerization promoting protein/p25, beta-amyloid, and alpha-synuclein. (PMID: 21832049) Oláh J … Ovádi J (The Journal of biological chemistry 2011) 3 58

Products for MROH8 Gene

Sources for MROH8 Gene

Content
Loading form....