Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MN1 Gene

Aliases for MN1 Gene

  • MN1 Proto-Oncogene, Transcriptional Regulator 2 3 5
  • Probable Tumor Suppressor Protein MN1 2 3 4
  • Meningioma (Disrupted In Balanced Translocation) 1 2 3
  • Meningioma (Translocation Balanced) 3
  • Meningioma Chromosome Region 1 3
  • Transcriptional Activator MN1 3
  • Meningioma Chromosome Region 2
  • DJ353E16.2 3
  • MGCR1-PEN 3
  • MGCR1 3
  • MGCR 3

External Ids for MN1 Gene

Previous HGNC Symbols for MN1 Gene

  • MGCR

Previous GeneCards Identifiers for MN1 Gene

  • GC22M024840
  • GC22M026468
  • GC22M028144
  • GC22M011108

Summaries for MN1 Gene

Entrez Gene Summary for MN1 Gene

  • Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]

GeneCards Summary for MN1 Gene

MN1 (MN1 Proto-Oncogene, Transcriptional Regulator) is a Protein Coding gene. Diseases associated with MN1 include Meningioma, Familial and Mn1.

UniProtKB/Swiss-Prot for MN1 Gene

  • Transcriptional activator which specifically regulates expression of TBX22 in the posterior region of the developing palate. Required during later stages of palate development for growth and medial fusion of the palatal shelves. Promotes maturation and normal function of calvarial osteoblasts, including expression of the osteoclastogenic cytokine TNFSF11/RANKL. Necessary for normal development of the membranous bones of the skull (By similarity). May play a role in tumor suppression (Probable).

Gene Wiki entry for MN1 Gene

Additional gene information for MN1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MN1 Gene

Genomics for MN1 Gene

GeneHancer (GH) Regulatory Elements for MN1 Gene

Promoters and enhancers for MN1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH22J027799 Promoter/Enhancer 2 EPDnew Ensembl ENCODE dbSUPER 650.7 +0.2 206 3.4 SREBF2 ZSCAN4 SIN3A YY1 ZNF335 GLIS2 SCRT2 SP3 YY2 ZNF398 MN1 GC22P027739
GH22J027789 Promoter/Enhancer 1.6 EPDnew FANTOM5 ENCODE dbSUPER 657.5 +10.6 10585 2.2 ZBTB21 KLF17 FEZF1 ZFHX2 ZNF366 PATZ1 SCRT2 PRDM10 ZNF600 ZNF843 MN1 GC22P027739
GH22J027668 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 19.6 +131.4 131373 3.6 HDGF PKNOX1 FOXA2 DMAP1 SP5 NFYC REST ZNF592 KAT8 SSRP1 MN1 ENSG00000227838 PITPNB ENSG00000231495 ENSG00000224027
GH22J027863 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 14.4 -66.3 -66332 9.6 FOXA2 FEZF1 ZNF2 BRCA1 YY1 FOS NFKBIZ RXRA REST MAFF PITPNB TTC28-AS1 MN1 TTC28 GC22M027880
GH22J027717 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 11.4 +82.7 82724 3.3 PKNOX1 ATF1 BRCA1 GLIS2 KLF7 ATF7 FOS DEK NFYC NCOA1 MN1 PITPNB ENSG00000226169 GC22P027739
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MN1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MN1 gene promoter:
  • Pax-5
  • RP58
  • AP-2alpha
  • AP-2alphaA
  • AP-2beta
  • AP-2gamma
  • SEF-1 (1)
  • AREB6
  • Roaz
  • Meis-1

Genomic Locations for MN1 Gene

Genomic Locations for MN1 Gene
chr22:27,748,277-27,801,498
(GRCh38/hg38)
Size:
53,222 bases
Orientation:
Minus strand
chr22:28,144,265-28,197,486
(GRCh37/hg19)
Size:
53,222 bases
Orientation:
Minus strand

Genomic View for MN1 Gene

Genes around MN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MN1 Gene

Proteins for MN1 Gene

  • Protein details for MN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q10571-MN1_HUMAN
    Recommended name:
    Transcriptional activator MN1
    Protein Accession:
    Q10571
    Secondary Accessions:
    • A9Z1V9

    Protein attributes for MN1 Gene

    Size:
    1320 amino acids
    Molecular mass:
    136001 Da
    Quaternary structure:
    No Data Available

neXtProt entry for MN1 Gene

Post-translational modifications for MN1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for MN1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for MN1 Gene

Domains & Families for MN1 Gene

Gene Families for MN1 Gene

Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for MN1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for MN1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MN1: view

No data available for UniProtKB/Swiss-Prot for MN1 Gene

Function for MN1 Gene

Molecular function for MN1 Gene

UniProtKB/Swiss-Prot Function:
Transcriptional activator which specifically regulates expression of TBX22 in the posterior region of the developing palate. Required during later stages of palate development for growth and medial fusion of the palatal shelves. Promotes maturation and normal function of calvarial osteoblasts, including expression of the osteoclastogenic cytokine TNFSF11/RANKL. Necessary for normal development of the membranous bones of the skull (By similarity). May play a role in tumor suppression (Probable).

Phenotypes From GWAS Catalog for MN1 Gene

Gene Ontology (GO) - Molecular Function for MN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0005515 protein binding IEA --
genes like me logo Genes that share ontologies with MN1: view
genes like me logo Genes that share phenotypes with MN1: view

Human Phenotype Ontology for MN1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for MN1 Gene

MGI Knock Outs for MN1:
  • Mn1 Mn1<tm1Ecz>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MN1

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for MN1 Gene

Localization for MN1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MN1 gene
Compartment Confidence
nucleus 3
cytosol 3
plasma membrane 1
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
genes like me logo Genes that share ontologies with MN1: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for MN1 Gene

Pathways & Interactions for MN1 Gene

No Data Available

SIGNOR curated interactions for MN1 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for MN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001957 intramembranous ossification IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with MN1: view

No data available for Pathways by source for MN1 Gene

Drugs & Compounds for MN1 Gene

(1) Additional Compounds for MN1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with MN1: view

Transcripts for MN1 Gene

mRNA/cDNA for MN1 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(61) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for MN1 Gene

Meningioma (disrupted in balanced translocation) 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MN1

Alternative Splicing Database (ASD) splice patterns (SP) for MN1 Gene

No ASD Table

Relevant External Links for MN1 Gene

GeneLoc Exon Structure for
MN1
ECgene alternative splicing isoforms for
MN1

Expression for MN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MN1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for MN1 Gene

This gene is overexpressed in Muscle - Skeletal (x8.8) and Artery - Tibial (x4.4).

Protein differential expression in normal tissues from HIPED for MN1 Gene

This gene is overexpressed in Monocytes (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MN1 Gene



Protein tissue co-expression partners for MN1 Gene

NURSA nuclear receptor signaling pathways regulating expression of MN1 Gene:

MN1

SOURCE GeneReport for Unigene cluster for MN1 Gene:

Hs.268515

mRNA Expression by UniProt/SwissProt for MN1 Gene:

Q10571-MN1_HUMAN
Tissue specificity: Ubiquitously expressed. Highest levels in skeletal muscle.

Evidence on tissue expression from TISSUES for MN1 Gene

  • Nervous system(4.8)
  • Muscle(3)
  • Urine(2.6)
  • Kidney(2.2)
  • Liver(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for MN1 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
Regions:
Head and neck:
  • head
  • meninges
genes like me logo Genes that share expression patterns with MN1: view

Orthologs for MN1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for MN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MN1 33
  • 98.78 (n)
dog
(Canis familiaris)
Mammalia MN1 34 33
  • 90.24 (n)
OneToOne
cow
(Bos Taurus)
Mammalia MN1 34 33
  • 89.06 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Mn1 16 34 33
  • 85.3 (n)
rat
(Rattus norvegicus)
Mammalia Mn1 33
  • 85.13 (n)
oppossum
(Monodelphis domestica)
Mammalia MN1 34
  • 75 (a)
OneToOne
chicken
(Gallus gallus)
Aves MN1 34
  • 72 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia mn1.1 33
  • 63.35 (n)
zebrafish
(Danio rerio)
Actinopterygii mn1b 34 33
  • 61.16 (n)
OneToMany
mn1a 34
  • 44 (a)
OneToMany
Species where no ortholog for MN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MN1 Gene

ENSEMBL:
Gene Tree for MN1 (if available)
TreeFam:
Gene Tree for MN1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MN1: view image

Paralogs for MN1 Gene

No data available for Paralogs for MN1 Gene

Variants for MN1 Gene

Sequence variations from dbSNP and Humsavar for MN1 Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs147334255 likely-pathogenic, uncertain-significance, Inborn genetic diseases, not specified 27,750,995(-) G/A coding_sequence_variant, stop_gained
rs747503495 other, Hepatoblastoma 27,799,615(-) TGCTGCTGCTGCTGCTGCTG/TGCTGCTGCTGCTGCTG/TGCTGCTGCTGCTGCTGCTGCTG/TGCTGCTGCTGCTGCTGCTGCTGCTGCTG coding_sequence_variant, inframe_deletion, inframe_insertion
rs1000062591 -- 27,793,664(-) A/G intron_variant
rs1000089883 -- 27,786,730(-) T/C intron_variant
rs1000148363 -- 27,755,723(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for MN1 Gene

Variant ID Type Subtype PubMed ID
dgv1312e212 CNV loss 25503493
esv2056669 CNV deletion 18987734
esv2210205 CNV deletion 18987734
esv2675305 CNV deletion 23128226
esv2724116 CNV deletion 23290073
esv3647497 CNV loss 21293372
nsv1071786 CNV deletion 25765185
nsv518700 CNV gain 19592680
nsv588872 CNV gain 21841781
nsv829144 CNV gain 20364138
nsv829145 CNV gain 20364138
nsv829146 CNV gain 20364138

Variation tolerance for MN1 Gene

Residual Variation Intolerance Score: 3.31% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.00; 74.86% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MN1 Gene

Human Gene Mutation Database (HGMD)
MN1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MN1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MN1 Gene

Disorders for MN1 Gene

MalaCards: The human disease database

(6) MalaCards diseases for MN1 Gene - From: HGMD, OMIM, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
meningioma, familial
  • meningioma, familial, susceptibility to
mn1
  • meningioma 1 gene
orthostatic proteinuria
  • postural albuminuria
urethral syndrome
  • urethral disease
pyuria
  • pus cells in urine
- elite association - COSMIC cancer census association via MalaCards
Search MN1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

MN1_HUMAN
  • Note=A chromosomal aberration involving MN1 may be a cause of acute myeloid leukemia (AML). Translocation t(12;22)(p13;q11) with ETV6. {ECO:0000269 PubMed:7731705}.
  • Note=Defects in MN1 involved in the development of meningiomas, slowly growing benign tumors derived from the arachnoidal cap cells of the leptomeninges, the soft coverings of the brain and spinal cord. Meningiomas are believed to be the most common primary tumors of the central nervous system in man. {ECO:0000269 PubMed:7731706}.

Additional Disease Information for MN1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MN1: view

No data available for Genatlas for MN1 Gene

Publications for MN1 Gene

  1. Cloning and characterization of MN1, a gene from chromosome 22q11, which is disrupted by a balanced translocation in a meningioma. (PMID: 7731706) Lekanne Deprez RH … Kley NA (Oncogene 1995) 2 3 4 22 58
  2. Translocation (12;22) (p13;q11) in myeloproliferative disorders results in fusion of the ETS-like TEL gene on 12p13 to the MN1 gene on 22q11. (PMID: 7731705) Buijs A … Hagemeijer A (Oncogene 1995) 3 4 22 58
  3. Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. (PMID: 19240061) Trynka G … Wijmenga C (Gut 2009) 3 44 58
  4. MN1 affects expression of genes involved in hematopoiesis and can enhance as well as inhibit RAR/RXR-induced gene expression. (PMID: 18632758) Meester-Smoor MA … Zwarthoff EC (Carcinogenesis 2008) 3 22 58
  5. The MN1 oncoprotein activates transcription of the IGFBP5 promoter through a CACCC-rich consensus sequence. (PMID: 17242174) Meester-Smoor MA … Zwarthoff EC (Journal of molecular endocrinology 2007) 3 22 58

Products for MN1 Gene

Sources for MN1 Gene

Content
Loading form....