This gene encodes a protein that catalyzes the final step in the conversion of vitamin B(12) into adenosylcobalamin (AdoCbl), a vitamin B12-containing coenzyme for methylmalonyl-CoA mutase. Mutations in the gene are the cause of vitamin B12-dependent methylmalonic aciduria linked to the cblB complementation group. Alternatively spliced transcript variants have been found. [prov... See more...

Aliases for MMAB Gene

Aliases for MMAB Gene

  • Metabolism Of Cobalamin Associated B 2 3 5
  • Methylmalonic Aciduria (Cobalamin Deficiency) CblB Type 2 3
  • Cob(II)Yrinic Acid A,C-Diamide Adenosyltransferase 3 4
  • Cobinamide/Cobalamin Adenosyltransferase 3 4
  • Cilia And Flagella Associated Protein 23 2 3
  • Methylmalonic Aciduria Type B Protein 3 4
  • ATP:Cob(I)Alamin Adenosyltransferase 2 3
  • Cob(II)Alamin Adenosyltransferase 3 4
  • Corrinoid Adenosyltransferase 3 4
  • Cob(I)Yrinic Acid A,C-Diamide Adenosyltransferase, Mitochondrial 3
  • Methylmalonic Aciduria (Cobalamin Deficiency) Type B 2
  • Aquocob(I)Alamin Vitamin B12s Adenosyltransferase 3
  • ATP:Corrinoid Adenosyltransferase 3
  • EC 2.5.1.17 4
  • CFAP23 3
  • CblB 3
  • ATR 3
  • Cob 3

External Ids for MMAB Gene

Previous GeneCards Identifiers for MMAB Gene

  • GC12U900014
  • GC12M109886
  • GC12M108455
  • GC12M109991
  • GC12M107009

Summaries for MMAB Gene

Entrez Gene Summary for MMAB Gene

  • This gene encodes a protein that catalyzes the final step in the conversion of vitamin B(12) into adenosylcobalamin (AdoCbl), a vitamin B12-containing coenzyme for methylmalonyl-CoA mutase. Mutations in the gene are the cause of vitamin B12-dependent methylmalonic aciduria linked to the cblB complementation group. Alternatively spliced transcript variants have been found. [provided by RefSeq, Apr 2011]

GeneCards Summary for MMAB Gene

MMAB (Metabolism Of Cobalamin Associated B) is a Protein Coding gene. Diseases associated with MMAB include Methylmalonic Aciduria, Cblb Type and Methylmalonic Acidemia. Among its related pathways are Porphyrin and chlorophyll metabolism and Metabolism. Gene Ontology (GO) annotations related to this gene include cob(I)yrinic acid a,c-diamide adenosyltransferase activity.

UniProtKB/Swiss-Prot Summary for MMAB Gene

  • Adenosyltransferase involved in intracellular vitamin B12 metabolism. Generates adenosylcobalamin (AdoCbl) and directly delivers the cofactor to MUT in a transfer taht is stimulated by ATP-binding to MMAB and gated by MMAA.

Gene Wiki entry for MMAB Gene

Additional gene information for MMAB Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for MMAB Gene

Genomics for MMAB Gene

GeneHancer (GH) Regulatory Elements for MMAB Gene

Promoters and enhancers for MMAB Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12J109571 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE CraniofacialAtlas 750.6 +0.1 91 3.8 ZNF785 SIN3A ZBTB40 SP1 SREBF1 ZBTB6 FOXA1 MLX RBPJ SMARCE1 MVK HSALNG0093900 MMAB lnc-KCTD10-2 UBE3B ANAPC7 TCHP KCTD10 IFT81 RNU4-32P
GH12J109713 Promoter/Enhancer 2 Ensembl ENCODE CraniofacialAtlas dbSUPER 10.9 -143.7 -143699 8.2 E2F8 SIN3A SP1 ZBTB40 CTCF SIX5 FOXA1 POLR2A TCF7L2 ATF1 ANAPC7 UBE3B C12orf76 TCHP RNU4-32P MMAB MVK TRPV4 GLTP HVCN1
GH12J109540 Enhancer 0.8 Ensembl ENCODE dbSUPER 19.2 +31.4 31412 3 MLLT1 ZBTB17 RCOR1 CTCF SMAD4 RARA HSALNG0093893 KCTD10 MVK MMAB RNU4-32P MYO1H piR-41954 UBE3B
GH12J109706 Enhancer 1.4 Ensembl ENCODE CraniofacialAtlas dbSUPER 11 -133.7 -133677 1.3 FOXA1 MLX NR2F1 NR2F6 MIXL1 HLF RAD21 ZNF280D ELF3 SP1 RF00017-1259 RNU4-32P MMAB MVK RF00100-032 RN7SKP250 lnc-MMAB-1
GH12J109709 Enhancer 1.2 Ensembl ENCODE dbSUPER 11 -136.6 -136551 2.3 GTF3C2 RBPJ NR2F6 MIXL1 MNT ELF3 SP1 ZNF548 ZNF24 PPARG RF00017-1259 RNU4-32P UBE3B MMAB MVK FAM222A
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MMAB on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MMAB gene promoter:
  • SREBP-1a
  • SREBP-1b
  • SREBP-1c

Genomic Locations for MMAB Gene

Genomic Locations for MMAB Gene
chr12:109,553,715-109,573,580
(GRCh38/hg38)
Size:
19,866 bases
Orientation:
Minus strand
chr12:109,991,520-110,011,679
(GRCh37/hg19)
Size:
20,160 bases
Orientation:
Minus strand

Genomic View for MMAB Gene

Genes around MMAB on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MMAB Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MMAB Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MMAB Gene

Proteins for MMAB Gene

  • Protein details for MMAB Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96EY8-MMAB_HUMAN
    Recommended name:
    Corrinoid adenosyltransferase
    Protein Accession:
    Q96EY8
    Secondary Accessions:
    • C5HU05
    • Q9BSH0

    Protein attributes for MMAB Gene

    Size:
    250 amino acids
    Molecular mass:
    27388 Da
    Quaternary structure:
    • Homotrimer.

    Three dimensional structures from OCA and Proteopedia for MMAB Gene

neXtProt entry for MMAB Gene

Post-translational modifications for MMAB Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for MMAB Gene

Domains & Families for MMAB Gene

Gene Families for MMAB Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Protein Domains for MMAB Gene

Suggested Antigen Peptide Sequences for MMAB Gene

GenScript: Design optimal peptide antigens:
  • Methylmalonic aciduria type B protein (MMAB_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96EY8

UniProtKB/Swiss-Prot:

MMAB_HUMAN :
  • Belongs to the Cob(I)alamin adenosyltransferase family.
Family:
  • Belongs to the Cob(I)alamin adenosyltransferase family.
genes like me logo Genes that share domains with MMAB: view

Function for MMAB Gene

Molecular function for MMAB Gene

UniProtKB/Swiss-Prot Function:
Adenosyltransferase involved in intracellular vitamin B12 metabolism. Generates adenosylcobalamin (AdoCbl) and directly delivers the cofactor to MUT in a transfer taht is stimulated by ATP-binding to MMAB and gated by MMAA.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=2 ATP + 2 cob(II)yrinate a,c diamide + reduced [electron-transfer flavoprotein] = 2 adenosylcob(III)yrinate a,c-diamide + 3 H(+) + oxidized [electron-transfer flavoprotein] + 2 triphosphate; Xref=Rhea:RHEA:11528, Rhea:RHEA-COMP:10685, Rhea:RHEA-COMP:10686, ChEBI:CHEBI:15378, ChEBI:CHEBI:18036, ChEBI:CHEBI:30616, ChEBI:CHEBI:57692, ChEBI:CHEBI:58307, ChEBI:CHEBI:58503, ChEBI:CHEBI:58537; EC=2.5.1.17;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=2 ATP + 2 cob(II)alamin + reduced [electron-transfer flavoprotein] = 2 adenosylcob(III)alamin + 3 H(+) + oxidized [electron-transfer flavoprotein] + 2 triphosphate; Xref=Rhea:RHEA:28671, Rhea:RHEA-COMP:10685, Rhea:RHEA-COMP:10686, ChEBI:CHEBI:15378, ChEBI:CHEBI:16304, ChEBI:CHEBI:18036, ChEBI:CHEBI:18408, ChEBI:CHEBI:30616, ChEBI:CHEBI:57692, ChEBI:CHEBI:58307; EC=2.5.1.17;.

Enzyme Numbers (IUBMB) for MMAB Gene

Phenotypes From GWAS Catalog for MMAB Gene

Gene Ontology (GO) - Molecular Function for MMAB Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25910212
GO:0005524 ATP binding IEA --
GO:0008817 cob(I)yrinic acid a,c-diamide adenosyltransferase activity IBA,IDA 12514191
GO:0016740 transferase activity IEA --
GO:0031419 cobalamin binding IDA 28497574
genes like me logo Genes that share ontologies with MMAB: view
genes like me logo Genes that share phenotypes with MMAB: view

Human Phenotype Ontology for MMAB Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for MMAB Gene

miRTarBase miRNAs that target MMAB

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MMAB

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for MMAB Gene

Localization for MMAB Gene

Subcellular locations from UniProtKB/Swiss-Prot for MMAB Gene

Mitochondrion.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MMAB gene
Compartment Confidence
mitochondrion 5
peroxisome 0
nucleus 0
cytosol 0

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MMAB Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005759 mitochondrial matrix TAS --
genes like me logo Genes that share ontologies with MMAB: view

Pathways & Interactions for MMAB Gene

genes like me logo Genes that share pathways with MMAB: view

UniProtKB/Swiss-Prot Q96EY8-MMAB_HUMAN

  • Pathway: Cofactor biosynthesis; adenosylcobalamin biosynthesis; adenosylcobalamin from cob(II)yrinate a,c-diamide: step 2/7.

Gene Ontology (GO) - Biological Process for MMAB Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009235 cobalamin metabolic process TAS 28497574
GO:0009236 cobalamin biosynthetic process IEA --
genes like me logo Genes that share ontologies with MMAB: view

No data available for SIGNOR curated interactions for MMAB Gene

Drugs & Compounds for MMAB Gene

(7) Drugs for MMAB Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Hydroxocobalamin Approved Pharma Target, other 401
Cyanocobalamin Approved Nutra Enzyme, substrate 402
Cobamamide Approved Pharma 0
Manganese Approved Nutra 48
ATP Investigational Nutra Agonist, Activator, Full agonist, Antagonist, Pore Blocker, Potentiation 0

(7) Additional Compounds for MMAB Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Adenosyl cobinamide
  • 5'-Deoxy-5'-adenosylcobinamide
  • Adenosylcob(III)inamide
Adenosyl cobyrinic acid a,c diamide
  • Adenosyl cobyrinate a,c diamide
  • Adenosyl cobyrinate diamide
  • Adenosylcobyrinic acid a,c-diamide
  • Adenosyl cobyrinic acid a,c diamide
  • Adenosylcob(III)yrinate a,c-diamide
adenosylcob(III)yrinic acid a,c-diamide
  • Adenosyl cobyrinate a,c diamide
  • Adenosyl cobyrinate diamide
  • Adenosylcobyrinic acid a,c-diamide
  • Adenosyl cobyrinic acid a,c diamide
  • Adenosylcob(III)yrinate a,c-diamide
Cob(I)alamin
  • Vitamin b-12S
  • Vitamin b12S
  • Cyanocobalamin
  • Hydrido-cobalamin
  • Hydridocobalamin
18534-66-2
Cob(I)yrinate a,c diamide
  • Cob(I)yrinate diamide
  • Cob(I)yrinic acid a,c-diamide
  • Cob(I)yrinic acid diamide
  • Cob(I)yrinic acid a,c diamide
  • Cob(I)yrinate a,c-diamide
genes like me logo Genes that share compounds with MMAB: view

Transcripts for MMAB Gene

mRNA/cDNA for MMAB Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MMAB

Alternative Splicing Database (ASD) splice patterns (SP) for MMAB Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b · 13c · 13d
SP1: - - - - - - -
SP2: - - - - - -
SP3: - - - - - - -
SP4: - - - - - -
SP5: - - - - - - - - -
SP6: - - - - - - - - -
SP7: - - - - - - - -
SP8: - - - - - - - -
SP9: - - - -
SP10: -
SP11: - - - - -
SP12: - - -
SP13: - - - -
SP14: - -
SP15: -

Relevant External Links for MMAB Gene

GeneLoc Exon Structure for
MMAB
ECgene alternative splicing isoforms for
MMAB

Expression for MMAB Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MMAB Gene

mRNA differential expression in normal tissues according to GTEx for MMAB Gene

This gene is overexpressed in Liver (x4.0).

Protein differential expression in normal tissues from HIPED for MMAB Gene

This gene is overexpressed in Liver (8.0) and Fetal testis (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for MMAB Gene



Protein tissue co-expression partners for MMAB Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MMAB Gene:

MMAB

SOURCE GeneReport for Unigene cluster for MMAB Gene:

Hs.12106

mRNA Expression by UniProt/SwissProt for MMAB Gene:

Q96EY8-MMAB_HUMAN
Tissue specificity: Expressed in liver and skeletal muscle.

Evidence on tissue expression from TISSUES for MMAB Gene

  • Liver(4.4)
  • Lung(4.2)
  • Nervous system(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for MMAB Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • lymphatic
  • nervous
  • respiratory
  • skeletal muscle
Regions:
Head and neck:
  • brain
  • head
Thorax:
  • esophagus
  • lung
Abdomen:
  • liver
  • stomach
General:
  • blood
  • bone marrow
  • coagulation system
  • red blood cell
  • white blood cell
genes like me logo Genes that share expression patterns with MMAB: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for MMAB Gene

Orthologs for MMAB Gene

This gene was present in the common ancestor of animals.

Orthologs for MMAB Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MMAB 33 32
  • 98.61 (n)
OneToOne
dog
(Canis familiaris)
Mammalia MMAB 33 32
  • 88.13 (n)
OneToOne
cow
(Bos Taurus)
Mammalia MMAB 33 32
  • 87.95 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Mmab 17 33 32
  • 86.15 (n)
rat
(Rattus norvegicus)
Mammalia Mmab 32
  • 82.97 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia MMAB 33
  • 77 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia MMAB 33
  • 66 (a)
OneToOne
chicken
(Gallus gallus)
Aves -- 33
  • 64 (a)
OneToMany
-- 33
  • 64 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii mmab 33 32
  • 66 (n)
OneToOne
Dr.18617 32
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.4954 32
worm
(Caenorhabditis elegans)
Secernentea mmab-1 33
  • 40 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 50 (a)
OneToOne
Species where no ortholog for MMAB was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for MMAB Gene

ENSEMBL:
Gene Tree for MMAB (if available)
TreeFam:
Gene Tree for MMAB (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MMAB: view image

Paralogs for MMAB Gene

(5) SIMAP similar genes for MMAB Gene using alignment to 7 proteins:

  • MMAB_HUMAN
  • F5H079_HUMAN
  • F5H0C1_HUMAN
  • F5H4Z7_HUMAN
  • J3KN55_HUMAN
  • S4R3P5_HUMAN
  • S4R3Z1_HUMAN
genes like me logo Genes that share paralogs with MMAB: view

No data available for Paralogs for MMAB Gene

Variants for MMAB Gene

Sequence variations from dbSNP and Humsavar for MMAB Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs104895295 pathogenic, Hyperimmunoglobulin D with periodic fever, Mevalonic aciduria 109,574,881(-) A/C/G upstream_transcript_variant
rs104895307 not-provided, Hyperimmunoglobulin D with periodic fever 109,574,859(-) A/T upstream_transcript_variant
rs104895309 not-provided, Hyperimmunoglobulin D with periodic fever 109,574,807(-) AGGATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAGG/AGG upstream_transcript_variant
rs104895322 pathogenic, not-provided, Mevalonic aciduria, Hyperimmunoglobulin D with periodic fever 109,574,894(-) T/TT upstream_transcript_variant
rs104895328 not-provided, Hyperimmunoglobulin D with periodic fever 109,574,844(-) G/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MMAB Gene

Variant ID Type Subtype PubMed ID
esv3630719 CNV gain 21293372
nsv560118 CNV loss 21841781

Variation tolerance for MMAB Gene

Residual Variation Intolerance Score: 72% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.62; 86.25% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MMAB Gene

Human Gene Mutation Database (HGMD)
MMAB
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MMAB

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MMAB Gene

Disorders for MMAB Gene

MalaCards: The human disease database

(5) MalaCards diseases for MMAB Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
methylmalonic aciduria, cblb type
  • methylmalonic acidemia, cblb type
methylmalonic acidemia
  • methylmalonic aciduria
isolated methylmalonic acidemia
  • methylmalonic acidemia
mevalonic aciduria
  • periodic fever, dutch type
organic acidemia
  • organic acid metabolism disorder
- elite association - COSMIC cancer census association via MalaCards
Search MMAB in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

MMAB_HUMAN
  • Methylmalonic aciduria type cblB (MMAB) [MIM:251110]: A disorder of methylmalonate and cobalamin metabolism due to defective synthesis of adenosylcobalamin. {ECO:0000269 PubMed:12471062, ECO:0000269 PubMed:15781192, ECO:0000269 PubMed:17957493}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for MMAB

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MMAB: view

No data available for Genatlas for MMAB Gene

Publications for MMAB Gene

  1. Identification of the human and bovine ATP:Cob(I)alamin adenosyltransferase cDNAs based on complementation of a bacterial mutant. (PMID: 12514191) Leal NA … Bobik TA (The Journal of biological chemistry 2003) 2 3 4 23 56
  2. Identification of the gene responsible for the cblB complementation group of vitamin B12-dependent methylmalonic aciduria. (PMID: 12471062) Dobson CM … Gravel RA (Human molecular genetics 2002) 2 3 4 23 56
  3. Genetic analysis of three genes causing isolated methylmalonic acidemia: identification of 21 novel allelic variants. (PMID: 15781192) Martínez MA … Pérez B (Molecular genetics and metabolism 2005) 3 4 23 56
  4. Protein destabilization and loss of protein-protein interaction are fundamental mechanisms in cblA-type methylmalonic aciduria. (PMID: 28497574) Plessl T … Froese DS (Human mutation 2017) 3 4 56
  5. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 43 56

Products for MMAB Gene

Sources for MMAB Gene