Aliases for MLLT6 Gene

Aliases for MLLT6 Gene

  • MLLT6, PHD Finger Containing 2 3 5
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia, Translocated To, 6 2 3
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia; Translocated To, 6 2 3
  • ALL1-Fused Gene From Chromosome 17 Protein 3 4
  • MLLT6, PHD Finger Domain Containing 2 3
  • Trithorax Homolog 2 3
  • Protein AF-17 3 4
  • AF17 3 4
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax (Drosophila) Homolog); Translocated To, 6 2
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila); Translocated To, 6 3
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog); Translocated To, 6 3

External Ids for MLLT6 Gene

Previous GeneCards Identifiers for MLLT6 Gene

  • GC17P036347
  • GC17P038855
  • GC17P036772
  • GC17P037236
  • GC17P034115
  • GC17P036861
  • GC17P032658

Summaries for MLLT6 Gene

GeneCards Summary for MLLT6 Gene

MLLT6 (MLLT6, PHD Finger Containing) is a Protein Coding gene. An important paralog of this gene is MLLT10.

Additional gene information for MLLT6 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for MLLT6 Gene

Genomics for MLLT6 Gene

GeneHancer (GH) Regulatory Elements for MLLT6 Gene

Promoters and enhancers for MLLT6 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J038699 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 756.5 -1.8 -1765 8 GTF3C2 SIN3A SP1 ZBTB40 LCORL MLX RBPJ SMARCE1 POLR2A TCF7L2 MLLT6 ENSG00000277969 LOC105371764 MIR4734 CDK12 LOC105371762 SNORA21 RPL23 MED1 PCGF2
GH17J038724 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 16.7 +23.9 23920 10.8 SIN3A SP1 ZBTB40 CTCF SMARCE1 RBPJ NR2F6 HCFC1 MIXL1 MYC CISD3 ENSG00000279119 lnc-PCGF2-3 LASP1 PCGF2 CDK12 LOC105371762 FBXL20 MED1 MLLT6
GH17J038673 Promoter/Enhancer 1.7 Ensembl ENCODE CraniofacialAtlas 12.7 -31.0 -31041 2.2 ZNF785 MLX RBPJ POLR2A USF2 MIXL1 MYC NFYC L3MBTL2 MAX EPOP lnc-PCGF2-5 PCGF2 PIP4K2B MLLT6 CISD3 PSMB3 CWC25
GH17J038740 Enhancer 1.1 FANTOM5 ENCODE dbSUPER 15.9 +37.0 37013 3.6 ZNF362 ZNF121 NFIB SP1 GLIS2 PKNOX1 ZIC2 RFX1 PRDM10 ZSCAN4 C17orf98 PCGF2 MLLT6 FBXO47 PIP4K2B FBXL20 SOCS7 PSMB3 CISD3 hsa-miR-5095-223
GH17J038677 Enhancer 1 ENCODE 12.7 -28.3 -28319 0.2 CTCF RBPJ USF2 CREB1 MIXL1 MYC CC2D1A L3MBTL2 MAX DACH1 EPOP MLLT6 PCGF2 CISD3 PIP4K2B PSMB3 CWC25 piR-57133-257
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MLLT6 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MLLT6 gene promoter:
  • ATF
  • HSF1short
  • NF-1
  • NF-1/L
  • NF-kappaB
  • NF-kappaB1
  • NF-kappaB2
  • Pax-5
  • YY1
  • ZIC2

Genomic Locations for MLLT6 Gene

Genomic Locations for MLLT6 Gene
chr17:38,705,542-38,729,803
(GRCh38/hg38)
Size:
24,262 bases
Orientation:
Plus strand
chr17:36,861,795-36,886,056
(GRCh37/hg19)
Size:
24,262 bases
Orientation:
Plus strand

Genomic View for MLLT6 Gene

Genes around MLLT6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MLLT6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MLLT6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MLLT6 Gene

Proteins for MLLT6 Gene

  • Protein details for MLLT6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P55198-AF17_HUMAN
    Recommended name:
    Protein AF-17
    Protein Accession:
    P55198
    Secondary Accessions:
    • Q59F28
    • Q96IU3
    • Q9H5F6
    • Q9UF49

    Protein attributes for MLLT6 Gene

    Size:
    1093 amino acids
    Molecular mass:
    112048 Da
    Quaternary structure:
    • Interacts with histone H3; interaction is necessary for MLLT6 binding to nucleosomes; interaction is inhibited by histone H3 'Lys-27' methylations (H3K27me1, H3K27me2 and H3K27me3).
    SequenceCaution:
    • Sequence=AAH07237.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAB15670.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

neXtProt entry for MLLT6 Gene

Post-translational modifications for MLLT6 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for MLLT6 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for MLLT6 Gene

Domains & Families for MLLT6 Gene

Gene Families for MLLT6 Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for MLLT6 Gene

GenScript: Design optimal peptide antigens:
  • ALL1-fused gene from chromosome 17 protein (AF17_HUMAN)
  • MLLT6 protein (Q6P2C6_HUMAN)
  • MLLT6 protein (Q96I32_HUMAN)
genes like me logo Genes that share domains with MLLT6: view

No data available for Graphical View of Domain Structure and UniProtKB/Swiss-Prot for MLLT6 Gene

Function for MLLT6 Gene

Molecular function for MLLT6 Gene

GENATLAS Biochemistry:
AF-17 protein,fused with HRX (MLL),in acute lymphoblastic leukemia and monoblastic leukemia with granulocytic sarcomas,with translocation t(11;17)(q23;q21),may be the same as TCF11

Phenotypes From GWAS Catalog for MLLT6 Gene

Gene Ontology (GO) - Molecular Function for MLLT6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16713569
GO:0031491 nucleosome binding IDA 26439302
GO:0042393 histone binding IPI 26439302
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with MLLT6: view
genes like me logo Genes that share phenotypes with MLLT6: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MLLT6

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MLLT6 Gene

Localization for MLLT6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MLLT6 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MLLT6 gene
Compartment Confidence
nucleus 4
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MLLT6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
genes like me logo Genes that share ontologies with MLLT6: view

Pathways & Interactions for MLLT6 Gene

PathCards logo

SuperPathways for MLLT6 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MLLT6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006355 regulation of transcription, DNA-templated TAS 8058765
GO:0007588 excretion IEA --
GO:0010765 positive regulation of sodium ion transport IEA --
GO:0035811 negative regulation of urine volume IEA --
GO:0035812 renal sodium excretion IEA --
genes like me logo Genes that share ontologies with MLLT6: view

No data available for Pathways by source and SIGNOR curated interactions for MLLT6 Gene

Drugs & Compounds for MLLT6 Gene

No Compound Related Data Available

Transcripts for MLLT6 Gene

mRNA/cDNA for MLLT6 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MLLT6

Alternative Splicing Database (ASD) splice patterns (SP) for MLLT6 Gene

No ASD Table

Relevant External Links for MLLT6 Gene

GeneLoc Exon Structure for
MLLT6
ECgene alternative splicing isoforms for
MLLT6

Expression for MLLT6 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MLLT6 Gene

Protein differential expression in normal tissues from HIPED for MLLT6 Gene

This gene is overexpressed in Brain (65.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MLLT6 Gene



NURSA nuclear receptor signaling pathways regulating expression of MLLT6 Gene:

MLLT6

SOURCE GeneReport for Unigene cluster for MLLT6 Gene:

Hs.91531

Evidence on tissue expression from TISSUES for MLLT6 Gene

  • Intestine(4.5)
  • Skin(4.3)
  • Spleen(4.3)
  • Nervous system(3.5)
  • Lung(2.6)
  • Kidney(2.1)
genes like me logo Genes that share expression patterns with MLLT6: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MLLT6 Gene

Orthologs for MLLT6 Gene

This gene was present in the common ancestor of animals.

Orthologs for MLLT6 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MLLT6 32
  • 99.83 (n)
dog
(Canis familiaris)
Mammalia MLLT6 32
  • 92.78 (n)
cow
(Bos Taurus)
Mammalia MLLT6 32
  • 92.31 (n)
mouse
(Mus musculus)
Mammalia Mllt6 17 32
  • 88.47 (n)
rat
(Rattus norvegicus)
Mammalia Mllt6 32
  • 88.33 (n)
chicken
(Gallus gallus)
Aves MLLT6 32
  • 69.9 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia mllt6 32
  • 63.16 (n)
worm
(Caenorhabditis elegans)
Secernentea zfp-1 34
  • 60 (a)
Species where no ortholog for MLLT6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for MLLT6 Gene

ENSEMBL:
Gene Tree for MLLT6 (if available)
TreeFam:
Gene Tree for MLLT6 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MLLT6: view image

Paralogs for MLLT6 Gene

Paralogs for MLLT6 Gene

(10) SIMAP similar genes for MLLT6 Gene using alignment to 5 proteins:

  • AF17_HUMAN
  • E9PEP1_HUMAN
  • J3KSE4_HUMAN
  • Q6P2C6_HUMAN
  • Q96I32_HUMAN
genes like me logo Genes that share paralogs with MLLT6: view

Variants for MLLT6 Gene

Sequence variations from dbSNP and Humsavar for MLLT6 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1000002940 -- 38,703,962(+) A/T upstream_transcript_variant
rs1000007336 -- 38,722,027(+) C/T coding_sequence_variant, synonymous_variant
rs1000096086 -- 38,714,429(+) A/G intron_variant
rs1000192790 -- 38,703,913(+) C/G/T upstream_transcript_variant
rs1000297533 -- 38,726,355(+) GTGTGTGTGTGCGTGCATGTGTGTGTGTGTGTGTG/GTGTGTGTGTG 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for MLLT6 Gene

Variant ID Type Subtype PubMed ID
esv21810 CNV gain 19812545
nsv1071381 CNV deletion 25765185
nsv1126456 CNV deletion 24896259
nsv1146669 OTHER inversion 26484159
nsv470585 CNV loss 18288195
nsv833438 CNV loss 17160897
nsv953894 CNV deletion 24416366

Variation tolerance for MLLT6 Gene

Residual Variation Intolerance Score: 8.63% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.49; 55.22% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MLLT6 Gene

Human Gene Mutation Database (HGMD)
MLLT6
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MLLT6

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MLLT6 Gene

Disorders for MLLT6 Gene

UniProtKB/Swiss-Prot

AF17_HUMAN
  • Note=A chromosomal aberration involving MLLT6 is associated with acute leukemias. Translocation t(11;17)(q23;q21) with KMT2A/MLL1. The result is a rogue activator protein.

Additional Disease Information for MLLT6

No disorders were found for MLLT6 Gene.

No data available for MalaCards and Genatlas for MLLT6 Gene

Publications for MLLT6 Gene

  1. Leucine-zipper dimerization motif encoded by the AF17 gene fused to ALL-1 (MLL) in acute leukemia. (PMID: 8058765) Prasad R … Canaani E (Proceedings of the National Academy of Sciences of the United States of America 1994) 2 3 4 56
  2. The PZP Domain of AF10 Senses Unmodified H3K27 to Regulate DOT1L-Mediated Methylation of H3K79. (PMID: 26439302) Chen S … Gozani O (Molecular cell 2015) 3 4 56
  3. Af17 deficiency increases sodium excretion and decreases blood pressure. (PMID: 21546577) Chen L … Zhang W (Journal of the American Society of Nephrology : JASN 2011) 2 3 56
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56

Products for MLLT6 Gene

Sources for MLLT6 Gene