Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR6879 Gene

Subcategory (RNA class) for MIR6879 Gene

miRNA

Quality Score for this RNA gene is

13

Aliases for MIR6879 Gene

  • MicroRNA 6879 2 3 5
  • MicroRNA Mir-6879 3
  • Hsa-Mir-6879 3

External Ids for MIR6879 Gene

Previous GeneCards Identifiers for MIR6879 Gene

  • GC11U902154

Summaries for MIR6879 Gene

Entrez Gene Summary for MIR6879 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR6879 Gene

MIR6879 (MicroRNA 6879) is an RNA Gene, and is affiliated with the miRNA class.

Additional gene information for MIR6879 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR6879 Gene

Genomics for MIR6879 Gene

GeneHancer (GH) Regulatory Elements for MIR6879 Gene

Promoters and enhancers for MIR6879 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J065017 Promoter 0.7 EPDnew 600.7 -0.5 -516 0.1 ZKSCAN1 ZNF507 ARL2 MIR6879 MAJIN ARL2-SNX15
GH11J065012 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 0.7 -4.3 -4295 2.7 SP1 ZFX CC2D1A CTCF CBFA2T2 ZNF148 NKRF MLLT1 ZNF121 GTF2F1 ARL2-SNX15 ARL2 BATF2 ENSG00000257086 EIF1AD POLA2 PCNX3 ZFPL1 SF1 ZNRD2
GH11J065015 Promoter 0.6 Ensembl 0.7 -2.8 -2804 0.2 ZBTB33 ARL2-SNX15 ARL2 SPDYC MIR6879
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MIR6879 on UCSC Golden Path with GeneCards custom track

Genomic Locations for MIR6879 Gene

Genomic Locations for MIR6879 Gene
chr11:65,018,505-65,018,570
(GRCh38/hg38)
Size:
66 bases
Orientation:
Plus strand

Genomic View for MIR6879 Gene

Genes around MIR6879 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR6879 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR6879 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR6879 Gene

Proteins for MIR6879 Gene

Post-translational modifications for MIR6879 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR6879 Gene

Domains & Families for MIR6879 Gene

Gene Families for MIR6879 Gene

HGNC:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR6879: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR6879 Gene

Function for MIR6879 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR6879 Gene

Localization for MIR6879 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for MIR6879 Gene

Pathways & Interactions for MIR6879 Gene

PathCards logo

SuperPathways for MIR6879 Gene

No Data Available

Interacting Proteins for MIR6879 Gene

Gene Ontology (GO) - Biological Process for MIR6879 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for MIR6879 Gene

Drugs & Compounds for MIR6879 Gene

No Compound Related Data Available

Transcripts for MIR6879 Gene

mRNA/cDNA for MIR6879 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(3) RNA Central transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR6879 Gene

No ASD Table

Relevant External Links for MIR6879 Gene

GeneLoc Exon Structure for
MIR6879
ECgene alternative splicing isoforms for
MIR6879

Expression for MIR6879 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR6879 Gene:

MIR6879
No Expression Related Data Available

Primer Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MIR6879 Gene

Orthologs for MIR6879 Gene

Evolution for MIR6879 Gene

ENSEMBL:
Gene Tree for MIR6879 (if available)
TreeFam:
Gene Tree for MIR6879 (if available)

No data available for Orthologs for MIR6879 Gene

Paralogs for MIR6879 Gene

No data available for Paralogs for MIR6879 Gene

Variants for MIR6879 Gene

Sequence variations from dbSNP and Humsavar for MIR6879 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1000117241 -- 65,016,642(+) CCTGTGTGTGCCTGTGTGTGCC/CCTGTGTGTGCC upstream_transcript_variant
rs1000221831 -- 65,017,768(+) T/C upstream_transcript_variant
rs1000956240 -- 65,016,676(+) T/G upstream_transcript_variant
rs1001300035 -- 65,017,043(+) C/T upstream_transcript_variant
rs1001533496 -- 65,017,837(+) A/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MIR6879 Gene

Variant ID Type Subtype PubMed ID
esv3626667 CNV loss 21293372
esv3626668 CNV gain 21293372
nsv526181 CNV gain 19592680

Additional Variant Information for MIR6879 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MIR6879

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR6879 Gene

Disorders for MIR6879 Gene

Additional Disease Information for MIR6879

No disorders were found for MIR6879 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR6879 Gene

Publications for MIR6879 Gene

  1. Discovery of hundreds of mirtrons in mouse and human small RNA data. (PMID: 22955976) Ladewig E … Lai EC (Genome research 2012) 3 58
  2. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S … Enright AJ (Nucleic acids research 2006) 3 58

Products for MIR6879 Gene

Sources for MIR6879 Gene

Content
Loading form....