Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MED16 Gene

Aliases for MED16 Gene

  • Mediator Complex Subunit 16 2 3 4 5
  • Thyroid Hormone Receptor-Associated Protein Complex 95 KDa Component 3 4
  • Vitamin D3 Receptor-Interacting Protein Complex 92 KDa Component 3 4
  • Thyroid Hormone Receptor-Associated Protein 5 3 4
  • TRAP95 3 4
  • THRAP5 3 4
  • DRIP92 3 4
  • Thyroid Hormone Receptor-Associated Protein, 95-KD Subunit 3
  • Mediator Of RNA Polymerase II Transcription Subunit 16 3
  • Thyroid Hormone Receptor Associated Protein 5 2

External Ids for MED16 Gene

Previous HGNC Symbols for MED16 Gene

  • THRAP5

Previous GeneCards Identifiers for MED16 Gene

  • GC19M000819
  • GC19M000640
  • GC19M000884
  • GC19M000889
  • GC19M000906

Summaries for MED16 Gene

GeneCards Summary for MED16 Gene

MED16 (Mediator Complex Subunit 16) is a Protein Coding gene. Among its related pathways are PEDF Induced Signaling and Thyroid hormone signaling pathway. Gene Ontology (GO) annotations related to this gene include receptor activity and transcription cofactor activity.

UniProtKB/Swiss-Prot for MED16 Gene

  • Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors.

Gene Wiki entry for MED16 Gene

Additional gene information for MED16 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MED16 Gene

Genomics for MED16 Gene

GeneHancer (GH) Regulatory Elements for MED16 Gene

Promoters and enhancers for MED16 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I000892 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 565.6 +0.2 230 2.3 HDGF FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF766 ZNF207 MED16 GC19P000897 RNU6-9 WDR18 GC19M000880 PIR31785
GH19I000891 Enhancer 0.7 ENCODE dbSUPER 550.8 +1.6 1642 0.2 SCRT1 PKNOX1 SCRT2 KLF8 GC19P000897 MED16 RNU6-9 GC19M000880 PIR31785
GH19I001236 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 48.9 -363.6 -363641 41.1 CLOCK MLX ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF416 CIRBP C19orf24 MIDN CBARP ATP5F1D SF3A2 TCF3 TMEM259 LOC100288123 PTBP1
GH19I001019 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 50.1 -128.0 -127989 4.4 MLX ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF416 ZNF143 TMEM259 GC19P001025 RNU6-2 TCF3 LOC100288123 DAZAP1 GRIN3B PTBP1 CIRBP MED16
GH19I001437 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 48.7 -546.3 -546265 4.3 MLX DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC RPS15 ENSG00000268798 SF3A2 TCF3 TMEM259 LOC100288123 PTBP1 DAZAP1 MED16 ENSG00000267317
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MED16 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MED16 gene promoter:

Genomic Locations for MED16 Gene

Genomic Locations for MED16 Gene
chr19:867,630-893,218
(GRCh38/hg38)
Size:
25,589 bases
Orientation:
Minus strand
chr19:867,962-893,218
(GRCh37/hg19)

Genomic View for MED16 Gene

Genes around MED16 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MED16 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MED16 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MED16 Gene

Proteins for MED16 Gene

  • Protein details for MED16 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9Y2X0-MED16_HUMAN
    Recommended name:
    Mediator of RNA polymerase II transcription subunit 16
    Protein Accession:
    Q9Y2X0
    Secondary Accessions:
    • Q6PJT2
    • Q96AD4
    • Q96I35
    • Q9Y652

    Protein attributes for MED16 Gene

    Size:
    877 amino acids
    Molecular mass:
    96793 Da
    Quaternary structure:
    • Component of the Mediator complex, which is composed of MED1, MED4, MED6, MED7, MED8, MED9, MED10, MED11, MED12, MED13, MED13L, MED14, MED15, MED16, MED17, MED18, MED19, MED20, MED21, MED22, MED23, MED24, MED25, MED26, MED27, MED29, MED30, MED31, CCNC, CDK8 and CDC2L6/CDK11. The MED12, MED13, CCNC and CDK8 subunits form a distinct module termed the CDK8 module. Mediator containing the CDK8 module is less active than Mediator lacking this module in supporting transcriptional activation. Individual preparations of the Mediator complex lacking one or more distinct subunits have been variously termed ARC, CRSP, DRIP, PC2, SMCC and TRAP.
    SequenceCaution:
    • Sequence=AAD31087.1; Type=Frameshift; Positions=609; Evidence={ECO:0000305};

    Alternative splice isoforms for MED16 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MED16 Gene

Post-translational modifications for MED16 Gene

  • Ubiquitination at isoforms=2, 3, 4, 526, posLast=149149, posLast=158158, isoforms=2, 3, 4, 5252, posLast=284284, posLast=338338, posLast=574574, posLast=745745, isoforms=2, 3808, and isoforms=2, 3817

No data available for DME Specific Peptides for MED16 Gene

Domains & Families for MED16 Gene

Gene Families for MED16 Gene

Graphical View of Domain Structure for InterPro Entry

Q9Y2X0

UniProtKB/Swiss-Prot:

MED16_HUMAN :
  • Belongs to the Mediator complex subunit 16 family.
Family:
  • Belongs to the Mediator complex subunit 16 family.
genes like me logo Genes that share domains with MED16: view

Function for MED16 Gene

Molecular function for MED16 Gene

UniProtKB/Swiss-Prot Function:
Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors.

Phenotypes From GWAS Catalog for MED16 Gene

Gene Ontology (GO) - Molecular Function for MED16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003712 transcription cofactor activity IDA 12218053
GO:0003713 transcription coactivator activity TAS 10198638
GO:0003824 catalytic activity IEA --
GO:0004872 receptor activity IDA 12218053
GO:0005515 protein binding IPI 24882805
genes like me logo Genes that share ontologies with MED16: view
genes like me logo Genes that share phenotypes with MED16: view

Animal Models for MED16 Gene

MGI Knock Outs for MED16:

miRNA for MED16 Gene

miRTarBase miRNAs that target MED16

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for MED16 Gene

Localization for MED16 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MED16 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MED16 gene
Compartment Confidence
nucleus 5
plasma membrane 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MED16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS 10198638
GO:0005654 nucleoplasm TAS --
GO:0016020 membrane IDA,HDA 19946888
GO:0016592 mediator complex IDA 10198638
genes like me logo Genes that share ontologies with MED16: view

Pathways & Interactions for MED16 Gene

genes like me logo Genes that share pathways with MED16: view

Pathways by source for MED16 Gene

Gene Ontology (GO) - Biological Process for MED16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006357 regulation of transcription by RNA polymerase II NAS 10198638
GO:0006366 transcription by RNA polymerase II TAS 10198638
GO:0006367 transcription initiation from RNA polymerase II promoter TAS --
genes like me logo Genes that share ontologies with MED16: view

No data available for SIGNOR curated interactions for MED16 Gene

Drugs & Compounds for MED16 Gene

No Compound Related Data Available

Transcripts for MED16 Gene

Unigene Clusters for MED16 Gene

Mediator complex subunit 16:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MED16 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^ 17 ^ 18 ^
SP1: - - -
SP2: - - -
SP3: - - - -
SP4: - - -
SP5: - - - -
SP6: - - - - - - - - - - - - -
SP7: - -
SP8:

ExUns: 19 ^ 20a · 20b
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:

Relevant External Links for MED16 Gene

GeneLoc Exon Structure for
MED16
ECgene alternative splicing isoforms for
MED16

Expression for MED16 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MED16 Gene

Protein differential expression in normal tissues from HIPED for MED16 Gene

This gene is overexpressed in Platelet (54.9) and Breast (9.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MED16 Gene



Protein tissue co-expression partners for MED16 Gene

NURSA nuclear receptor signaling pathways regulating expression of MED16 Gene:

MED16

SOURCE GeneReport for Unigene cluster for MED16 Gene:

Hs.365207

Evidence on tissue expression from TISSUES for MED16 Gene

  • Nervous system(2.9)
  • Muscle(2)
genes like me logo Genes that share expression patterns with MED16: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MED16 Gene

Orthologs for MED16 Gene

This gene was present in the common ancestor of animals.

Orthologs for MED16 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MED16 33 34
  • 97.92 (n)
dog
(Canis familiaris)
Mammalia MED16 33 34
  • 89.42 (n)
cow
(Bos Taurus)
Mammalia MED16 33 34
  • 88.14 (n)
rat
(Rattus norvegicus)
Mammalia Med16 33
  • 86.02 (n)
mouse
(Mus musculus)
Mammalia Med16 33 16 34
  • 85.65 (n)
oppossum
(Monodelphis domestica)
Mammalia MED16 34
  • 85 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia MED16 34
  • 55 (a)
OneToOne
chicken
(Gallus gallus)
Aves MED16 33 34
  • 78.23 (n)
lizard
(Anolis carolinensis)
Reptilia MED16 34
  • 88 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia med16 33
  • 71.46 (n)
Str.15997 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.16367 33
zebrafish
(Danio rerio)
Actinopterygii med16 33 34
  • 71.36 (n)
wufc29h12 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.1586 33
fruit fly
(Drosophila melanogaster)
Insecta MED16 33 34
  • 45.75 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 38 (a)
OneToMany
-- 34
  • 35 (a)
OneToMany
Species where no ortholog for MED16 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MED16 Gene

ENSEMBL:
Gene Tree for MED16 (if available)
TreeFam:
Gene Tree for MED16 (if available)

Paralogs for MED16 Gene

No data available for Paralogs for MED16 Gene

Variants for MED16 Gene

Sequence variations from dbSNP and Humsavar for MED16 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000020174 -- 876,948(-) GGGCCCCACCTGCCACGGGCCCC/GGGCCCC intron_variant
rs1000027356 -- 889,620(-) C/T intron_variant
rs1000035927 -- 871,307(-) C/T intron_variant
rs1000064151 -- 891,381(-) G/C intron_variant
rs1000134209 -- 894,656(-) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MED16 Gene

Variant ID Type Subtype PubMed ID
nsv953938 CNV deletion 24416366
nsv578177 CNV gain+loss 21841781
nsv578176 CNV loss 21841781
nsv578175 CNV gain+loss 21841781
nsv513505 CNV insertion 21212237
nsv470101 CNV loss 18288195
nsv2385 CNV insertion 18451855
nsv1160555 CNV deletion 26073780
nsv1146217 CNV deletion 26484159
nsv1143892 CNV deletion 24896259
nsv1135520 CNV deletion 24896259
nsv1071885 CNV deletion 25765185
esv3643375 CNV gain 21293372
esv3555830 CNV deletion 23714750
esv3473 CNV loss 18987735
esv3399640 CNV duplication 20981092
esv3331953 CNV duplication 20981092
esv28908 CNV gain 19812545
esv2717810 CNV deletion 23290073
esv2717809 CNV deletion 23290073
esv2717808 CNV deletion 23290073
esv2717805 CNV deletion 23290073
esv2717804 CNV deletion 23290073
esv2717803 CNV deletion 23290073
esv2717802 CNV deletion 23290073
esv2717801 CNV deletion 23290073
esv2670297 CNV deletion 23128226
esv2273959 CNV deletion 18987734
esv1010169 CNV insertion 20482838
dgv6179n54 CNV loss 21841781
dgv6178n54 CNV loss 21841781
dgv6177n54 CNV loss 21841781
dgv1681n106 CNV deletion 24896259
dgv134n111 CNV deletion 26073780

Variation tolerance for MED16 Gene

Residual Variation Intolerance Score: 1.25% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.94; 67.90% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MED16 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MED16

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MED16 Gene

Disorders for MED16 Gene

Additional Disease Information for MED16

No disorders were found for MED16 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MED16 Gene

Publications for MED16 Gene

  1. Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex. (PMID: 10235266) Rachez C … Freedman LP (Nature 1999) 2 3 4 58
  2. Identity between TRAP and SMCC complexes indicates novel pathways for the function of nuclear receptors and diverse mammalian activators. (PMID: 10198638) Ito M … Roeder RG (Molecular cell 1999) 2 3 4 58
  3. MED1/TRAP220 exists predominantly in a TRAP/ Mediator subpopulation enriched in RNA polymerase II and is required for ER-mediated transcription. (PMID: 15989967) Zhang X … Roeder RG (Molecular cell 2005) 3 4 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. A set of consensus mammalian mediator subunits identified by multidimensional protein identification technology. (PMID: 15175163) Sato S … Conaway RC (Molecular cell 2004) 3 4 58

Products for MED16 Gene

Sources for MED16 Gene

Content
Loading form....