Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MAP3K14-AS1 Gene

Subcategory (RNA class) for MAP3K14-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for MAP3K14-AS1 Gene

  • MAP3K14 Antisense RNA 1 2 3 5

External Ids for MAP3K14-AS1 Gene

Previous GeneCards Identifiers for MAP3K14-AS1 Gene

  • GC17P043341
  • GC17P043385
  • GC17P043408
  • GC17P043435
  • GC17P045248
  • GC17P045249
  • GC17P045250
  • GC17P045251
  • GC17P045252
  • GC17P045253
  • GC17P045254
  • GC17P045255

Summaries for MAP3K14-AS1 Gene

GeneCards Summary for MAP3K14-AS1 Gene

MAP3K14-AS1 (MAP3K14 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with MAP3K14-AS1 include Temporal Lobe Epilepsy and Nik Deficiency.

Additional gene information for MAP3K14-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MAP3K14-AS1 Gene

Genomics for MAP3K14-AS1 Gene

GeneHancer (GH) Regulatory Elements for MAP3K14-AS1 Gene

Promoters and enhancers for MAP3K14-AS1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J045246 Promoter/Enhancer 1.7 Ensembl ENCODE dbSUPER 650.7 +1.0 970 4.9 HDGF PKNOX1 ZFP64 ARID4B SIN3A YY1 SLC30A9 POLR2B ZNF213 E2F8 MAP3K14-AS1 ENSG00000233483 FMNL1 ENSG00000233175 GC17P045246 GC17P045270 SPATA32
GH17J045143 Promoter/Enhancer 2.2 FANTOM5 Ensembl ENCODE dbSUPER 37.6 -100.0 -99978 9.6 CLOCK MLX FEZF1 DMAP1 YBX1 IRF4 YY1 SLC30A9 ZNF213 E2F8 HEXIM1 GC17M045149 ENSG00000276728 ENSG00000262372 ASB16-AS1 UBTF TMUB2 ENSG00000224505 LINC02210 EFTUD2
GH17J045157 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 21.4 -87.5 -87477 5.4 ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 ZNF548 ENSG00000224505 HEXIM2 ENSG00000262372 UBTF TMUB2 ASB16-AS1 MAP3K14-AS1 EFTUD2 ENSG00000267788 RN7SL405P
GH17J045059 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 20 -186.2 -186179 4.9 CLOCK MLX ZFP64 DMAP1 IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 DCAKD PIR53442 NMT1 ENSG00000262372 ASB16-AS1 TMUB2 UBTF ENSG00000224505 EFTUD2 MAP3K14-AS1
GH17J044707 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 19.3 -539.3 -539258 2.3 FEZF1 DMAP1 YY1 ZNF213 ZNF143 SP3 SSRP1 ZNF610 NBN NR2C1 DBF4B TMUB2 ASB16-AS1 UBTF ENSG00000224505 EFTUD2 C17orf53 HEXIM1 MAP3K14-AS1 MAP3K14
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MAP3K14-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for MAP3K14-AS1 Gene

Genomic Locations for MAP3K14-AS1 Gene
20,706 bases
Plus strand
20,706 bases
Plus strand

Genomic View for MAP3K14-AS1 Gene

Genes around MAP3K14-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MAP3K14-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MAP3K14-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MAP3K14-AS1 Gene

Proteins for MAP3K14-AS1 Gene

Post-translational modifications for MAP3K14-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MAP3K14-AS1 Gene

Domains & Families for MAP3K14-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MAP3K14-AS1 Gene

Function for MAP3K14-AS1 Gene

Phenotypes From GWAS Catalog for MAP3K14-AS1 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MAP3K14-AS1 Gene

Localization for MAP3K14-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for MAP3K14-AS1 Gene

Pathways & Interactions for MAP3K14-AS1 Gene

SuperPathways for MAP3K14-AS1 Gene

No Data Available

Interacting Proteins for MAP3K14-AS1 Gene

Gene Ontology (GO) - Biological Process for MAP3K14-AS1 Gene


No data available for Pathways by source and SIGNOR curated interactions for MAP3K14-AS1 Gene

Drugs & Compounds for MAP3K14-AS1 Gene

No Compound Related Data Available

Transcripts for MAP3K14-AS1 Gene

mRNA/cDNA for MAP3K14-AS1 Gene

(8) Additional mRNA sequences :
(10) Ensembl transcripts including schematic representations, and UCSC links where relevant :
(15) RNA Central transcripts :

Unigene Clusters for MAP3K14-AS1 Gene

MAP3K14 antisense RNA 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MAP3K14-AS1 Gene

No ASD Table

Relevant External Links for MAP3K14-AS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MAP3K14-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MAP3K14-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for MAP3K14-AS1 Gene

This gene is overexpressed in Testis (x18.4).

SOURCE GeneReport for Unigene cluster for MAP3K14-AS1 Gene:

genes like me logo Genes that share expression patterns with MAP3K14-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MAP3K14-AS1 Gene

Orthologs for MAP3K14-AS1 Gene

Evolution for MAP3K14-AS1 Gene

Gene Tree for MAP3K14-AS1 (if available)
Gene Tree for MAP3K14-AS1 (if available)

No data available for Orthologs for MAP3K14-AS1 Gene

Paralogs for MAP3K14-AS1 Gene

No data available for Paralogs for MAP3K14-AS1 Gene

Variants for MAP3K14-AS1 Gene

Sequence variations from dbSNP and Humsavar for MAP3K14-AS1 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs56302559 likely-benign, NIK deficiency 45,267,442(+) T/C/G intron_variant
rs751517422 likely-benign, NIK deficiency 45,264,660(+) A/G intron_variant
rs1000096931 -- 45,251,357(+) T/A genic_upstream_transcript_variant, intron_variant
rs1000251424 -- 45,262,136(+) CTGTGATGTCGCCGCCTCTGTGA/CTGTGA intron_variant, non_coding_transcript_variant
rs1000335712 -- 45,263,553(+) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for MAP3K14-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv953904 CNV deletion 24416366
nsv1146669 OTHER inversion 26484159

Additional Variant Information for MAP3K14-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MAP3K14-AS1 Gene

Disorders for MAP3K14-AS1 Gene

MalaCards: The human disease database

(2) MalaCards diseases for MAP3K14-AS1 Gene - From: LncRNADisease and GeneCards

Disorder Aliases PubMed IDs
temporal lobe epilepsy
  • epilepsy, temporal lobe
nik deficiency
  • primary immunodeficiency with multifaceted aberrant lymphoid immunity
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for MAP3K14-AS1

genes like me logo Genes that share disorders with MAP3K14-AS1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MAP3K14-AS1 Gene

Publications for MAP3K14-AS1 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58

Products for MAP3K14-AS1 Gene

Sources for MAP3K14-AS1 Gene

Loading form....