This gene is one of two neighboring gene family members that encode mitochondrial enzymes which catalyze the oxidative deamination of amines, such as dopamine, norepinephrine, and serotonin. Mutation of this gene results in Brunner syndrome. This gene has also been associated with a variety of other psychiatric disorders, including antisocial behavior. Alternatively spliced tra... See more...

Aliases for MAOA Gene

Aliases for MAOA Gene

  • Monoamine Oxidase A 2 3 5
  • Amine Oxidase [Flavin-Containing] A 3 4
  • Monoamine Oxidase Type A 3 4
  • EC 1.4.3.4 4 54
  • MAO-A 3 4
  • EC 1.4.3 54
  • BRNRS 3

External Ids for MAOA Gene

Previous GeneCards Identifiers for MAOA Gene

  • GC0XP041545
  • GC0XP041794
  • GC0XP042360
  • GC0XP042636
  • GC0XP043271
  • GC0XP043400
  • GC0XP043515
  • GC0XP041246

Summaries for MAOA Gene

Entrez Gene Summary for MAOA Gene

  • This gene is one of two neighboring gene family members that encode mitochondrial enzymes which catalyze the oxidative deamination of amines, such as dopamine, norepinephrine, and serotonin. Mutation of this gene results in Brunner syndrome. This gene has also been associated with a variety of other psychiatric disorders, including antisocial behavior. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]

GeneCards Summary for MAOA Gene

MAOA (Monoamine Oxidase A) is a Protein Coding gene. Diseases associated with MAOA include Brunner Syndrome and Antisocial Personality Disorder. Among its related pathways are Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 and Cytochrome P450 - arranged by substrate type. Gene Ontology (GO) annotations related to this gene include oxidoreductase activity and primary amine oxidase activity. An important paralog of this gene is MAOB.

UniProtKB/Swiss-Prot Summary for MAOA Gene

  • Catalyzes the oxidative deamination of biogenic and xenobiotic amines and has important functions in the metabolism of neuroactive and vasoactive amines in the central nervous system and peripheral tissues. MAOA preferentially oxidizes biogenic amines such as 5-hydroxytryptamine (5-HT), norepinephrine and epinephrine.

Tocris Summary for MAOA Gene

  • Monoamine Oxidases (MAO) catalyze the oxidation of monoamines such as dopamine, serotonin and adrenalin. They are found bound to the outer membrane of mitochondria in most cell types in the body. Two subtypes of MAO have been identified: MAO-A and MAO-B.

Gene Wiki entry for MAOA Gene

Additional gene information for MAOA Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for MAOA Gene

Genomics for MAOA Gene

GeneHancer (GH) Regulatory Elements for MAOA Gene

Promoters and enhancers for MAOA Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XJ043654 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 805.8 +2.1 2093 6 SP1 CTCF SREBF1 POLR2A ATF1 CREB1 RAD21 ELF3 SP7 ZSCAN21 MAOA ENSG00000214019 piR-49322-677
GH0XJ043279 Promoter 0.7 EPDnew 750.1 -375.4 -375374 0.1 ZBTB40 ELF1 ZFX ATF1 NR2C1 POLR2A GABPA NR2C2 VEZF1 ENSG00000285899 IMPDH1P4 piR-30612-003 piR-32860-008 piR-39173-003 piR-47936-002 MAOA
GH0XJ043589 Enhancer 0.9 Ensembl ENCODE 58.7 -64.5 -64547 2 RAD21 ZNF652 ELF3 SP1 CEBPG PPARG SP5 KAT8 CEBPA RXRA piR-39858-684 MAOA HSALNG0137525
GH0XJ043692 Enhancer 1.2 Ensembl ENCODE dbSUPER 43.6 +39.2 39242 2.5 RBPJ NR2F6 CREB1 MIXL1 RAD21 MNT ELF3 SP1 NCOA3 TFE3 MAOA piR-48799-145 lnc-MAOA-4
GH0XJ043642 Enhancer 0.9 FANTOM5 Ensembl ENCODE 51.3 -11.4 -11406 3.8 ZNF316 NFE2 MAFK EMSY MAOA RF00017-8344
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MAOA on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MAOA gene promoter:
  • AP-1
  • ATF-2
  • c-Fos
  • c-Jun
  • MEF-2A

Genomic Locations for MAOA Gene

Genomic Locations for MAOA Gene
chrX:43,654,907-43,746,824
(GRCh38/hg38)
Size:
91,918 bases
Orientation:
Plus strand
chrX:43,515,409-43,606,068
(GRCh37/hg19)
Size:
90,660 bases
Orientation:
Plus strand

Genomic View for MAOA Gene

Genes around MAOA on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MAOA Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MAOA Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MAOA Gene

Proteins for MAOA Gene

  • Protein details for MAOA Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P21397-AOFA_HUMAN
    Recommended name:
    Amine oxidase [flavin-containing] A
    Protein Accession:
    P21397
    Secondary Accessions:
    • B4DF46
    • Q16426

    Protein attributes for MAOA Gene

    Size:
    527 amino acids
    Molecular mass:
    59682 Da
    Cofactor:
    Name=FAD; Xref=ChEBI:CHEBI:57692;
    Quaternary structure:
    • Monomer, homo- or heterodimer (containing two subunits of similar size). Each subunit contains a covalently bound flavin. Enzymatically active as monomer.

    Three dimensional structures from OCA and Proteopedia for MAOA Gene

    Alternative splice isoforms for MAOA Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MAOA Gene

Selected DME Specific Peptides for MAOA Gene

P21397:
  • AGERAARE
  • AIPPTLTAKIHFRPELP
  • VIGGGISGLSAAKLL
  • DYNNLWR
  • RVGGRTYT
  • GPTQNRILR
  • DNMGKEIP
  • RQPVGRI
  • WSGYMEGAV
  • PAIMGFILARK
  • LFVNINVTSEPH
  • VSALWFLWYVKQCGGTTRI
  • EPESKDVPA
  • FPPVWNP
  • FAGTETAT
  • VLEARDRVGGRT
  • ERNQLIQRLPMGA
  • PVHYEEKNWC
  • HEVSALWFLWYV
  • CELYAKVLGS
  • ERNLPSV
  • PVGRIFFAG

Post-translational modifications for MAOA Gene

  • Ubiquitination at Lys469
  • Modification sites at PhosphoSitePlus

Other Protein References for MAOA Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for MAOA

Domains & Families for MAOA Gene

Gene Families for MAOA Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • FDA approved drug targets
  • Predicted membrane proteins

Protein Domains for MAOA Gene

Suggested Antigen Peptide Sequences for MAOA Gene

GenScript: Design optimal peptide antigens:
  • Monoamine oxidase type A (AOFA_HUMAN)
  • cDNA FLJ61220, highly similar to Amine oxidase (flavin-containing) A (EC 1.4.3.4) (B4DF46_HUMAN)
  • Monoamine oxidase A (Q49A63_HUMAN)
  • cDNA FLJ76052, highly similar to Homo sapiens monoamine oxidase A (MAOA), nuclear gene encoding mitochondrial protein, mRNA (Q53YE7_HUMAN)
  • Monoamine oxidase A (Q5UL91_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P21397

UniProtKB/Swiss-Prot:

AOFA_HUMAN :
  • Belongs to the flavin monoamine oxidase family.
Family:
  • Belongs to the flavin monoamine oxidase family.
genes like me logo Genes that share domains with MAOA: view

Function for MAOA Gene

Molecular function for MAOA Gene

UniProtKB/Swiss-Prot Function:
Catalyzes the oxidative deamination of biogenic and xenobiotic amines and has important functions in the metabolism of neuroactive and vasoactive amines in the central nervous system and peripheral tissues. MAOA preferentially oxidizes biogenic amines such as 5-hydroxytryptamine (5-HT), norepinephrine and epinephrine.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=a secondary aliphatic amine + H2O + O2 = a primary amine + an aldehyde + H2O2; Xref=Rhea:RHEA:26414, ChEBI:CHEBI:15377, ChEBI:CHEBI:15379, ChEBI:CHEBI:16240, ChEBI:CHEBI:17478, ChEBI:CHEBI:58855, ChEBI:CHEBI:65296; EC=1.4.3.4;.
GENATLAS Biochemistry:
monoamine oxidase A,overexpressed in female panic disorders

Enzyme Numbers (IUBMB) for MAOA Gene

Phenotypes From GWAS Catalog for MAOA Gene

Gene Ontology (GO) - Molecular Function for MAOA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008131 primary amine oxidase activity IEA --
GO:0016491 oxidoreductase activity IEA --
genes like me logo Genes that share ontologies with MAOA: view
genes like me logo Genes that share phenotypes with MAOA: view

Human Phenotype Ontology for MAOA Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for MAOA Gene

MGI Knock Outs for MAOA:
  • Maoa Maoa<tm1Shih>

Animal Model Products

CRISPR Products

Clone Products

No data available for Transcription Factor Targets and HOMER Transcription for MAOA Gene

Localization for MAOA Gene

Subcellular locations from UniProtKB/Swiss-Prot for MAOA Gene

Mitochondrion outer membrane; Single-pass type IV membrane protein; Cytoplasmic side.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MAOA gene
Compartment Confidence
mitochondrion 5
nucleus 2
cytosol 2
plasma membrane 1
extracellular 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MAOA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IDA --
GO:0005741 mitochondrial outer membrane TAS 24252804
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with MAOA: view

Pathways & Interactions for MAOA Gene

genes like me logo Genes that share pathways with MAOA: view

SIGNOR curated interactions for MAOA Gene

Is activated by:

Gene Ontology (GO) - Biological Process for MAOA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006576 cellular biogenic amine metabolic process TAS 8211186
GO:0006584 catecholamine metabolic process IEA --
GO:0009967 positive regulation of signal transduction IEA --
GO:0019221 cytokine-mediated signaling pathway TAS --
GO:0042133 neurotransmitter metabolic process TAS --
genes like me logo Genes that share ontologies with MAOA: view

Drugs & Compounds for MAOA Gene

(132) Drugs for MAOA Gene - From: DrugBank, ApexBio, DGIdb, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Isocarboxazid Approved Pharma Target, inhibitor 2
Moclobemide Approved, Investigational Pharma Target, Target, Enzyme, antagonist, inhibitor 7
Phenelzine Approved Pharma Target, Enzyme, antagonist, substrate, inhibitor 10
Selegiline Approved, Investigational, Vet_approved Pharma Target, inhibitor 27
Tranylcypromine Approved, Investigational Pharma Target, inhibitor 26

(83) Additional Compounds for MAOA Gene - From: HMDB, Novoseek, and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
5-Methoxytryptamine
  • 2-(5-Methoxyindol-3-yl)ethylamine
  • 3-(2-Aminoethyl)-5-methoxyindole
  • 5-MeOT
  • 5-Methoxy-1H-indole-3-ethanamine
  • 5-MT
608-07-1
Normetanephrine
  • (+/-)-normetanephrine
  • (+/-)-alpha-(aminomethyl)-4-hydroxy-3-methoxy-benzenemethanol
  • 3-Methoxy-noradrenaline
  • 3-O-Methyl-noradrenaline
  • 4-(2-amino-1-Hydroxyethyl)-2-methoxyphenol
97-31-4
1-Methylhistamine
  • 1-Methyl-1H-imidazole-4-ethanamine
  • 1-Methyl-4-(2-aminoethyl)imidazole
  • 3-Methylhistamine
  • 4-(1-Aminoethyl)-1-methyl-1H-imidazole
  • Methylhistamine
501-75-7
1-Phenylethylamine
  • 1-amino-1-Phenylethane
  • 1-Phenethylamine
  • alpha-Aminoethylbenzene
  • alpha-Methylbenzenemethanamine
  • alpha-Methylbenzylamine
98-84-0
3,4-Dihydroxymandelaldehyde
  • 3,4-Dihydroxymandelic aldehyde
  • 3,4-Dihydroxyphenylglycolaldehyde
  • 3,4-Dihydroxyphenylglycolic aldehyde
  • alpha,3,4-Trihydroxybenzeneacetaldehyde
  • alpha,3,4-Trihydroxyphenylacetaldehyde
13023-73-9

(5) Tocris Compounds for MAOA Gene

Compound Action Cas Number
(R)-(-)-Deprenyl hydrochloride MAO-B inhibitor 14611-52-0
Bifemelane hydrochloride MAO-A and MAO-B inhibitor 62232-46-6
Lazabemide hydrochloride Selective MAO-B inhibitor 103878-83-7
Pirlindole mesylate MAO-A inhibitor 207572-66-5
Tetrindole mesylate MAO-A inhibitor 170964-68-8

(13) ApexBio Compounds for MAOA Gene

Compound Action Cas Number
2-BFI hydrochloride
BU 224 hydrochloride Antagonist of I2 Imidazoline receptor,potent and selective 205437-64-5
BU 226 hydrochloride Ligand at I2 imidazoline sites,high affinity and selectivity 1186195-56-1
BU 239 hydrochloride Ligand of imidazoline I2 receptor,potent and selective 1217041-98-9
Moclobemide (Ro 111163) Reversible inhibitor of MAO-A 71320-77-9
Paeonol MAO inhibitor;multi-functional phenolic compound 552-41-0
Pirlindole mesylate 207572-66-5
Procarbazine HCl Antineoplastic chemotherapy drug 366-70-1
RS 45041-190 hydrochloride 204274-74-8
Sennoside A Irritant laxative;mild MAO inhibitor 81-27-6
Tetrindole mesylate 170964-68-8
Tranylcypromine (2-PCPA) HCl Monoamine oxidase inhibitor 4548-34-9
Tranylcypromine hydrochloride 1986-47-6
genes like me logo Genes that share compounds with MAOA: view

Transcripts for MAOA Gene

mRNA/cDNA for MAOA Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MAOA Gene

No ASD Table

Relevant External Links for MAOA Gene

GeneLoc Exon Structure for
MAOA
ECgene alternative splicing isoforms for
MAOA

Expression for MAOA Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MAOA Gene

Protein differential expression in normal tissues from HIPED for MAOA Gene

This gene is overexpressed in Placenta (12.0), Nasal epithelium (9.2), Nasopharynx (7.5), and Adipocyte (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for MAOA Gene



Protein tissue co-expression partners for MAOA Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MAOA Gene:

MAOA

SOURCE GeneReport for Unigene cluster for MAOA Gene:

Hs.183109

mRNA Expression by UniProt/SwissProt for MAOA Gene:

P21397-AOFA_HUMAN
Tissue specificity: Heart, liver, duodenum, blood vessels and kidney.

Evidence on tissue expression from TISSUES for MAOA Gene

  • Nervous system(4.9)
  • Liver(4.7)
  • Intestine(2.8)
  • Adrenal gland(2.7)
  • Heart(2.7)
  • Kidney(2.7)
  • Blood(2.5)
  • Lung(2.4)
  • Thyroid gland(2.4)
  • Muscle(2.3)
  • Pancreas(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for MAOA Gene

Germ Layers:
  • ectoderm
Systems:
  • nervous
Regions:
Head and neck:
  • brain
  • head
genes like me logo Genes that share expression patterns with MAOA: view

No data available for mRNA differential expression in normal tissues for MAOA Gene

Orthologs for MAOA Gene

This gene was present in the common ancestor of chordates.

Orthologs for MAOA Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MAOA 33
  • 99 (a)
OneToOne
LOC743285 32
  • 98.8 (n)
dog
(Canis familiaris)
Mammalia MAOA 33 32
  • 86.65 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Maoa 17 33 32
  • 85.19 (n)
cow
(Bos Taurus)
Mammalia MAOA 33 32
  • 84.95 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Maoa 32
  • 84.57 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia MAOA 33
  • 79 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia MAOA 33
  • 73 (a)
OneToOne
chicken
(Gallus gallus)
Aves MAOA 33
  • 72 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia MAOA 33
  • 72 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100495198 32
  • 68.62 (n)
zebrafish
(Danio rerio)
Actinopterygii mao 33
  • 69 (a)
OneToMany
Species where no ortholog for MAOA was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MAOA Gene

ENSEMBL:
Gene Tree for MAOA (if available)
TreeFam:
Gene Tree for MAOA (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MAOA: view image

Paralogs for MAOA Gene

Paralogs for MAOA Gene

(1) SIMAP similar genes for MAOA Gene using alignment to 7 proteins:

  • AOFA_HUMAN
  • Q49A63_HUMAN
  • Q53YE7_HUMAN
  • Q5UL91_HUMAN
  • Q5UL94_HUMAN
  • Q5ULA3_HUMAN
  • Q5ULA9_HUMAN
genes like me logo Genes that share paralogs with MAOA: view

Variants for MAOA Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for MAOA Gene

AOFA_HUMAN-P21397
A polymorphism 1.2 kb upstream of the MAOA coding sequences consists of a 30-bp repeated sequence present in 3, 3.5, 4, or 5 copies. The polymorphism affect transcriptional activity of the MAOA gene promoter. Alleles with 3.5 or 4 copies of the repeat sequence are transcribed 2 to 10 times more efficiently than those with 3 or 5 copies of the repeat.

Sequence variations from dbSNP and Humsavar for MAOA Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs1135401773 likely-pathogenic, Monoamine oxidase A deficiency 43,731,325(+) G/A coding_sequence_variant, missense_variant
rs1137070 benign, not specified, History of neurodevelopmental disorder 43,744,144(+) T/C coding_sequence_variant, synonymous_variant
rs1346551029 risk-factor, pathogenic, Antisocial behavior, susceptibility to, Autism, severe 43,655,101(+) ACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACC/ACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACC/ACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACC/ACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACC/ACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACCAGTACCCGCACCAGTACCGGCACCGGCACC 5_prime_UTR_variant
rs138703731 conflicting-interpretations-of-pathogenicity, benign, likely-benign, not specified, Monoamine oxidase A deficiency, History of neurodevelopmental disorder 43,731,723(+) G/A coding_sequence_variant, synonymous_variant
rs1555947954 uncertain-significance, Inborn genetic diseases 43,711,965(+) A/G coding_sequence_variant, initiator_codon_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for MAOA Gene

Variant ID Type Subtype PubMed ID
esv21483 CNV gain 19812545
nsv1078108 CNV duplication 25765185
nsv1150180 CNV duplication 26484159
nsv517873 CNV gain 19592680

Variation tolerance for MAOA Gene

Residual Variation Intolerance Score: 18.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.60; 12.97% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MAOA Gene

Human Gene Mutation Database (HGMD)
MAOA
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MAOA

SNP Genotyping and Copy Number Assay Products

Disorders for MAOA Gene

MalaCards: The human disease database

(52) MalaCards diseases for MAOA Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
brunner syndrome
  • brnrs
antisocial personality disorder
  • asocial personality
social phobia
  • phobia social
conduct disorder
endogenous depression
  • unipolar depression
- elite association - COSMIC cancer census association via MalaCards
Search MAOA in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

AOFA_HUMAN
  • Brunner syndrome (BRNRS) [MIM:300615]: A form of X-linked non-dysmorphic mild mental retardation. Male patients are affected by borderline mental retardation and exhibit abnormal behavior, including disturbed regulation of impulsive aggression. Obligate female carriers have normal intelligence and behavior. {ECO:0000269 PubMed:8211186}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for MAOA

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MAOA: view

No data available for Genatlas for MAOA Gene

Publications for MAOA Gene

  1. A non-additive interaction of a functional MAO-A VNTR and testosterone predicts antisocial behavior. (PMID: 17429405) Sjöberg RL … Goldman D (Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 2008) 3 23 26 43 56
  2. Gene-gene interaction between COMT and MAOA potentially predicts the intelligence of attention-deficit hyperactivity disorder boys in China. (PMID: 19941049) Qian QJ … Faraone SV (Behavior genetics 2010) 3 23 43 56
  3. Association of VNTR polymorphisms in the MAOA promoter and DRD4 exon 3 with heroin dependence in male Chinese addicts. (PMID: 20218801) Chien CC … Lung FW (The world journal of biological psychiatry : the official journal of the World Federation of Societies of Biological Psychiatry 2010) 3 23 43 56
  4. Meta-analysis of the association between the monoamine oxidase-A gene and mood disorders. (PMID: 20010318) Fan M … Zhang J (Psychiatric genetics 2010) 3 23 43 56
  5. A common variant in DRD3 gene is associated with risperidone-induced extrapyramidal symptoms. (PMID: 19506579) Gassó P … Lafuente A (The pharmacogenomics journal 2009) 3 23 43 56

Products for MAOA Gene

Sources for MAOA Gene