Aliases for MAF Gene
Aliases for MAF Gene
- MAF BZIP Transcription Factor 2 3 5
- V-Maf Avian Musculoaponeurotic Fibrosarcoma Oncogene Homolog 2 3
- Proto-Oncogene C-Maf 3 4
- Avian Musculoaponeurotic Fibrosarcoma (MAF) Protooncogene 3
- V-Maf Musculoaponeurotic Fibrosarcoma Oncogene Homolog 4
- T Lymphocyte C-Maf Long Form 3
- Transcription Factor Maf 3
External Ids for MAF Gene
- HGNC: 6776
- Entrez Gene: 4094
- Ensembl: ENSG00000178573
- OMIM: 177075
- UniProtKB: O75444
Previous GeneCards Identifiers for MAF Gene
- GC16M070559
- GC16M080589
- GC16M079366
- GC16M079407
- GC16M078185
- GC16M079627
- GC16M065384
Summaries for MAF Gene
-
The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
GeneCards Summary for MAF Gene
MAF (MAF BZIP Transcription Factor) is a Protein Coding gene. Diseases associated with MAF include Ayme-Gripp Syndrome and Cataract 21, Multiple Types. Among its related pathways are C-MYB transcription factor network and Th2 Differentiation Pathway. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding. An important paralog of this gene is MAFB.
UniProtKB/Swiss-Prot for MAF Gene
-
Acts as a transcriptional activator or repressor. Involved in embryonic lens fiber cell development. Recruits the transcriptional coactivators CREBBP and/or EP300 to crystallin promoters leading to up-regulation of crystallin gene during lens fiber cell differentiation. Activates the expression of IL4 in T helper 2 (Th2) cells. Increases T-cell susceptibility to apoptosis by interacting with MYB and decreasing BCL2 expression. Together with PAX6, transactivates strongly the glucagon gene promoter through the G1 element. Activates transcription of the CD13 proximal promoter in endothelial cells. Represses transcription of the CD13 promoter in early stages of myelopoiesis by affecting the ETS1 and MYB cooperative interaction. Involved in the initial chondrocyte terminal differentiation and the disappearance of hypertrophic chondrocytes during endochondral bone development. Binds to the sequence 5-[GT]G[GC]N[GT]NCTCAGNN-3 in the L7 promoter. Binds to the T-MARE (Maf response element) sites of lens-specific alpha- and beta-crystallin gene promoters. Binds element G1 on the glucagon promoter. Binds an AT-rich region adjacent to the TGC motif (atypical Maf response element) in the CD13 proximal promoter in endothelial cells (By similarity). When overexpressed, represses anti-oxidant response element (ARE)-mediated transcription. Involved either as an oncogene or as a tumor suppressor, depending on the cell context. Binds to the ARE sites of detoxifying enzyme gene promoters.
Additional gene information for MAF Gene
- Monarch Initiative
- Search for MAF at DataMed
- Search for MAF at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MAF Gene
Genomics for MAF Gene
GeneHancer (GH) Regulatory Elements for MAF Gene
Promoters and enhancers for MAF Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around MAF on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the MAF gene promoter:
-
- c-Jun
- ATF-2
- AP-1
- E2F
- E2F-1
- E2F-3a
- E2F-4
Regulatory Element Products
Genomic Locations for MAF Gene
Genomic Locations for MAF Gene
- chr16:79,212,772-79,600,786
- (GRCh38/hg38)
- Size:
- 388,015 bases
- Orientation:
- Minus strand
- chr16:79,619,740-79,634,622
- (GRCh37/hg19)
- Size:
- 14,883 bases
- Orientation:
- Minus strand
Genomic View for MAF Gene
Genes around MAF on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 16q23.2 by Entrez Gene
- 16q23.2 by HGNC
- 16q23.2 by Ensembl
MAF Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for MAF Gene
Proteins for MAF Gene
-
Protein details for MAF Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- O75444-MAF_HUMAN
- Recommended name:
- Transcription factor Maf
- Protein Accession:
- O75444
- Q66I47
- Q9UP93
Protein attributes for MAF Gene
- Size:
- 373 amino acids
- Molecular mass:
- 38492 Da
- Quaternary structure:
-
- Homodimer or heterodimer with other bHLH-Zip transcription factors. Binds DNA as a homodimer or as a heterodimer. Heterotetramer of two MAF and two USF2. Interacts with PAX6; the interaction is direct. Interacts with MYB; interaction takes place weakly in normal T-cells and increases in T-cells following stimulation through the TCR engagement. Interacts with MYB; the ternary complex formed with MYB and the CD13 promoter is regulated in response to differentiating signals. Interacts with USF2; the interaction inhibits its DNA-binding activity on the L7 promoter. Interacts with CREBBP, EP300 and ETS1 (By similarity).
Protein Expression for MAF Gene
Post-translational modifications for MAF Gene
- Ubiquitinated, leading to its degradation by the proteasome. Ubiquitination is triggered by glucocorticoids.
- Phosphorylated by GSK3 and MAPK13 on serine and threonine residues (Probable). The phosphorylation status can serve to either stimulate or inhibit transcription.
- Modification sites at PhosphoSitePlus
- Modification sites at neXtProt
Other Protein References for MAF Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for MAF (c-Maf)
-
Custom Antibody ServicesOriGene Antibodies for MAF
- Novus Biologicals Antibodies for MAF
-
Abcam antibodies for MAF
- Invitrogen Antibodies for MAF (AFLGC-MAF)
- GeneTex MAF Antibody for MAF
-
Santa Cruz Biotechnology (SCBT) Antibodies for MAF
- Sino Biological Antibodies for MAF
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for MAF
- Origene Custom Protein Services for MAF
- Novus Biologicals proteins for MAF
- Search GeneTex for Proteins for MAF
-
Abcam proteins for MAF
Assay Products
No data available for DME Specific Peptides for MAF Gene
Domains & Families for MAF Gene
Gene Families for MAF Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for MAF Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for MAF Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
O75444- Family:
-
- Belongs to the bZIP family. Maf subfamily.
Function for MAF Gene
Molecular function for MAF Gene
- UniProtKB/Swiss-Prot Function:
- Acts as a transcriptional activator or repressor. Involved in embryonic lens fiber cell development. Recruits the transcriptional coactivators CREBBP and/or EP300 to crystallin promoters leading to up-regulation of crystallin gene during lens fiber cell differentiation. Activates the expression of IL4 in T helper 2 (Th2) cells. Increases T-cell susceptibility to apoptosis by interacting with MYB and decreasing BCL2 expression. Together with PAX6, transactivates strongly the glucagon gene promoter through the G1 element. Activates transcription of the CD13 proximal promoter in endothelial cells. Represses transcription of the CD13 promoter in early stages of myelopoiesis by affecting the ETS1 and MYB cooperative interaction. Involved in the initial chondrocyte terminal differentiation and the disappearance of hypertrophic chondrocytes during endochondral bone development. Binds to the sequence 5-[GT]G[GC]N[GT]NCTCAGNN-3 in the L7 promoter. Binds to the T-MARE (Maf response element) sites of lens-specific alpha- and beta-crystallin gene promoters. Binds element G1 on the glucagon promoter. Binds an AT-rich region adjacent to the TGC motif (atypical Maf response element) in the CD13 proximal promoter in endothelial cells (By similarity). When overexpressed, represses anti-oxidant response element (ARE)-mediated transcription. Involved either as an oncogene or as a tumor suppressor, depending on the cell context. Binds to the ARE sites of detoxifying enzyme gene promoters.
- UniProtKB/Swiss-Prot Induction:
- Up-regulated with tert-butyl hydroquinone (t-BHQ).
- GENATLAS Biochemistry:
- avian musculoaponeurotic fibrosarcoma (v-maf) oncogene homolog
Phenotypes From GWAS Catalog for MAF Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000981 | RNA polymerase II transcription factor activity, sequence-specific DNA binding | NAS | 19274049 |
| GO:0001228 | transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding | IEA | -- |
| GO:0003677 | DNA binding | IEA | -- |
| GO:0003700 | DNA binding transcription factor activity | IEA | -- |
| GO:0005515 | protein binding | IPI | 20102225 |
Phenotypes for MAF Gene
- MGI mutant phenotypes for MAF:
- inferred from 7 alleles
- GenomeRNAi human phenotypes for MAF:
Animal Models for MAF Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for MAF
-
CRISPR Products
-
OriGene CRISPR knockouts for MAF
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for MAF
- genomics-online: gRNA clones - Search results for available MAF gene related products
- Applied Biological Materials CRISPR for MAF
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for MAF
- GenScript: Design CRISPR guide RNA sequences for MAF
miRNA for MAF Gene
- miRTarBase miRNAs that target MAF
-
- hsa-mir-621 (MIRT285209)
- hsa-mir-302c-5p (MIRT497275)
- hsa-mir-6798-3p (MIRT497276)
- hsa-mir-3143 (MIRT497277)
- hsa-mir-4640-3p (MIRT497278)
- hsa-mir-499b-3p (MIRT497279)
- hsa-mir-499a-3p (MIRT497280)
- hsa-mir-618 (MIRT497281)
- hsa-mir-3942-3p (MIRT556358)
- hsa-mir-5100 (MIRT556359)
- hsa-mir-4531 (MIRT556360)
- hsa-mir-5703 (MIRT556361)
- hsa-mir-4516 (MIRT556362)
- hsa-mir-4434 (MIRT556363)
- hsa-mir-10b-3p (MIRT556364)
- hsa-mir-205-3p (MIRT556365)
- hsa-mir-6514-5p (MIRT556366)
- hsa-mir-4802-5p (MIRT556367)
- hsa-mir-451b (MIRT556368)
- hsa-mir-486-3p (MIRT733024)
- hsa-mir-212-5p (MIRT735187)
- hsa-mir-147a (MIRT783854)
- hsa-mir-210-3p (MIRT784200)
- hsa-mir-3151-5p (MIRT784681)
- hsa-mir-342-5p (MIRT784900)
- hsa-mir-3621 (MIRT784975)
- hsa-mir-3650 (MIRT784993)
- hsa-mir-3656 (MIRT785032)
- hsa-mir-3911 (MIRT785426)
- hsa-mir-4447 (MIRT785895)
- hsa-mir-4455 (MIRT785917)
- hsa-mir-4472 (MIRT785958)
- hsa-mir-4651 (MIRT786305)
- hsa-mir-4664-5p (MIRT786348)
- hsa-mir-491-5p (MIRT786902)
- hsa-mir-574-5p (MIRT787866)
- hsa-mir-608 (MIRT788056)
- hsa-mir-644a (MIRT788182)
- hsa-mir-6737-5p (MIRT788506)
- hsa-mir-6742-5p (MIRT788530)
- hsa-mir-6747-5p (MIRT788550)
- hsa-mir-6796-5p (MIRT788799)
- hsa-mir-6812-5p (MIRT788909)
- hsa-mir-6819-5p (MIRT788953)
- hsa-mir-6867-5p (MIRT789206)
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for MAF
- Browse OriGene Inhibitory RNA Products For MAF
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MAF
- genomics-online: shRNA clones - Search results for available MAF gene related products
Clone Products
- Sino Biological Human cDNA Clone for MAF
- Addgene plasmids for MAF
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for MAF
- genomics-online: cdna clones - Search results for available MAF gene related products
- orf clones - Search results for available MAF gene related products
- Applied Biological Materials Clones for MAF
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for MAF
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for MAF Gene
Localization for MAF Gene
Subcellular locations from UniProtKB/Swiss-Prot for MAF Gene
- Nucleus.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| plasma membrane | 2 |
| extracellular | 2 |
| cytosol | 2 |
| cytoskeleton | 1 |
| peroxisome | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000785 | chromatin | TAS | 9616139 |
| GO:0005634 | nucleus | IEA | -- |
| GO:0005737 | cytoplasm | IEA | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for MAF Gene
Pathways & Interactions for MAF Gene
Pathways by source for MAF Gene
3 BioSystems pathways for MAF Gene
1 PharmGKB pathway for MAF Gene
3 KEGG pathways for MAF Gene
1 R&D Systems pathway for MAF Gene
Interacting Proteins for MAF Gene
Selected Interacting proteins:
ENSP00000327048
O75444-MAF_HUMAN
for MAF Gene via
STRING
UniProtKB
IID
GPS-Prot Interaction Network for MAF
SIGNOR curated interactions for MAF Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000122 | negative regulation of transcription by RNA polymerase II | IEA | -- |
| GO:0001816 | cytokine production | IEA | -- |
| GO:0002088 | lens development in camera-type eye | IEA | -- |
| GO:0006351 | transcription, DNA-templated | IEA | -- |
| GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
Transcripts for MAF Gene
mRNA/cDNA for MAF Gene
- (6) REFSEQ mRNAs :
- (7) Additional mRNA sequences :
- (239) Selected AceView cDNA sequences:
- (3) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000569649 1217 bps (uc059xlc.1)
- ENST00000326043 2646 bps (uc002ffm.4)
- ENST00000393350 6384 bps (uc002ffn.4)
Unigene Clusters for MAF Gene
- V-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian):
- Representative Sequences:
CRISPR Products
-
OriGene CRISPR knockouts for MAF
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for MAF
- genomics-online: gRNA clones - Search results for available MAF gene related products
- Applied Biological Materials CRISPR for MAF
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for MAF
- GenScript: Design CRISPR guide RNA sequences for MAF
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for MAF
- Browse OriGene Inhibitory RNA Products For MAF
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MAF
- genomics-online: shRNA clones - Search results for available MAF gene related products
Clone Products
- Sino Biological Human cDNA Clone for MAF
- Addgene plasmids for MAF
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for MAF
- genomics-online: cdna clones - Search results for available MAF gene related products
- orf clones - Search results for available MAF gene related products
- Applied Biological Materials Clones for MAF
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for MAF Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Bone (Muscoskeletal System)
- Terminal Chondrocytes Caudal Facial Endochondral Bones
- Terminal Chondrocytes Mandibular Condyle
- Terminal Chondrocytes Rib
- Terminal Chondrocytes Stylopod Growth Plate
- Terminal Chondrocytes Autopod Growth Plate
-
Cartilage (Muscoskeletal System)
- Terminal Chondrocytes Caudal Facial Endochondral Bones
- Terminal Chondrocytes Mandibular Condyle
- Terminal Chondrocytes Rib
- Terminal Chondrocytes Stylopod Growth Plate
- Terminal Chondrocytes Autopod Growth Plate
This gene is overexpressed in Synovial fluid (69.0).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MAF Gene
NURSA nuclear receptor signaling pathways regulating expression of MAF Gene:
MAFSOURCE GeneReport for Unigene cluster for MAF Gene:
Hs.134859mRNA Expression by UniProt/SwissProt for MAF Gene:
O75444-MAF_HUMAN
Tissue specificity:
Expressed in endothelial cells.
Evidence on tissue expression from TISSUES for MAF Gene
- Kidney(3.6)
- Liver(2.8)
- Muscle(2.8)
- Nervous system(2.8)
- Blood(2.6)
- Intestine(2.6)
- Spleen(2.5)
- Pancreas(2.4)
- Skin(2.4)
- Eye(2.3)
- Lymph node(2.2)
- Bone marrow(2.1)
- Lung(2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for MAF Gene
Germ Layers:
- ectoderm
- mesoderm
Systems:
- digestive
- integumentary
- nervous
- skeletal muscle
- skeleton
Regions:
Head and neck:
- brain
- cheek
- cranial nerve
- ear
- eye
- eyelid
- face
- forehead
- head
- jaw
- lip
- mandible
- maxilla
- mouth
- nose
- outer ear
- skull
Limb:
- arm
- forearm
- radius
- ulna
- upper limb
General:
- hair
- peripheral nervous system
- skin
Primer Products
-
OriGene qPCR primer pairs for MAF
-
OriGene qPCR primer pairs and template standards for MAF
- genomics-online: primer clones - Search results for available MAF gene related products
Gene Expression Assay Products
No data available for mRNA differential expression in normal tissues for MAF Gene
Orthologs for MAF Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | MAF 34 33 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Maf 16 34 33 |
|
||
| cow (Bos Taurus) |
Mammalia | MAF 34 33 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Maf 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | MAF 34 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | MAF 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | MAF 34 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | MAF 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | Str.15477 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | maf 34 33 |
|
OneToOne | |
| fruit fly (Drosophila melanogaster) |
Insecta | tj 34 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | maf-1 34 |
|
OneToMany | |
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
ManyToMany |
- Species where no ortholog for MAF was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- dog (Canis familiaris)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for MAF Gene
- ENSEMBL:
- Gene Tree for MAF (if available)
- TreeFam:
- Gene Tree for MAF (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for MAF: view image
Paralogs for MAF Gene
Variants for MAF Gene
| SNP ID | Clin | Chr 16 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1057518878 | likely-pathogenic, Congenital cataract | 79,599,715(-) | G/C | coding_sequence_variant, missense_variant, non_coding_transcript_variant | |
| rs1060502729 | uncertain-significance, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12 | 79,211,713(-) | G/C | genic_downstream_transcript_variant, non_coding_transcript_variant | |
| rs1064792969 | uncertain-significance, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12 | 79,211,729(-) | CGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC/C | genic_downstream_transcript_variant, non_coding_transcript_variant | |
| rs117065412 | benign, uncertain-significance, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12, not specified | 79,211,789(-) | C/A/G | genic_downstream_transcript_variant, non_coding_transcript_variant | |
| rs121917735 | pathogenic, Cataract 21, multiple types, Cataract 21, multiple types (CTRCT21) [MIM:610202] | 79,599,040(-) | C/G/T | coding_sequence_variant, missense_variant, non_coding_transcript_variant |
Residual Variation Intolerance Score:
29.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
0.97;
20.09% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for MAF Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MAF Gene
Disorders for MAF Gene
(20) MalaCards diseases for MAF Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| ayme-gripp syndrome |
|
|
| cataract 21, multiple types |
|
|
| cerulean cataract |
|
|
| cataract microcornea syndrome |
|
|
| cataract 30, multiple types |
|
|
Search MAF in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
MAF_HUMAN- Note=A chromosomal aberration involving MAF is found in some forms of multiple myeloma (MM). Translocation t(14;16)(q32.3;q23) with an IgH locus.
- Cataract 21, multiple types (CTRCT21) [MIM:610202]: An opacification of the crystalline lens of the eye that frequently results in visual impairment or blindness. Opacities vary in morphology, are often confined to a portion of the lens, and may be static or progressive. In general, the more posteriorly located and dense an opacity, the greater the impact on visual function. CTRCT21 includes cerulean and pulverulent cataracts. Cerulean cataracts are characterized by peripheral bluish and white opacifications organized in concentric layers with occasional central lesions arranged radially. The opacities are observed in the superficial layers of the fetal nucleus as well as the adult nucleus of the lens. Involvement is usually bilateral. Visual acuity is only mildly reduced in childhood. In adulthood, the opacifications may progress, making lens extraction necessary. Histologically the lesions are described as fusiform cavities between lens fibers which contain a deeply staining granular material. Although the lesions may take on various colors, a dull blue is the most common appearance and is responsible for the designation cerulean cataract. Pulverulent cataracts are characterized by a dust-like, pulverised appearance of the opacities which can be found in any part of the lens. In some cases cataract is associated with microcornea without any other systemic anomaly or dysmorphism. Microcornea is defined by a corneal diameter inferior to 10 mm in both meridians in an otherwise normal eye. {ECO:0000269 PubMed:11772997, ECO:0000269 PubMed:16470690, ECO:0000269 PubMed:24664492}. Note=The disease is caused by mutations affecting the gene represented in this entry.
- Ayme-Gripp syndrome (AYGRP) [MIM:601088]: A multisystem disorder characterized by congenital cataracts, sensorineural deafness, intellectual disability, seizures, brachycephaly, distinctive flat facial appearance, skeletal anomalies, mammary gland hypoplasia, and reduced growth. {ECO:0000269 PubMed:25865493}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for MAF
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- Tumor Gene Database
- (TGDB)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for MAF Gene
Publications for MAF Gene
- CD13/APN transcription is regulated by the proto-oncogene c-Maf via an atypical response element. (PMID: 17897790) Mahoney KM … Shapiro LH (Gene 2007) 3 4 22 58
- A novel mutation in the DNA-binding domain of MAF at 16q23.1 associated with autosomal dominant "cerulean cataract" in an Indian family. (PMID: 16470690) Vanita V … Singh JR (American journal of medical genetics. Part A 2006) 3 4 22 58
- c-Maf negatively regulates ARE-mediated detoxifying enzyme genes expression and anti-oxidant induction. (PMID: 12149651) Dhakshinamoorthy S … Jaiswal AK (Oncogene 2002) 3 4 22 58
- Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma. (PMID: 11772997) Jamieson RV … Black GC (Human molecular genetics 2002) 3 4 22 58
- Mutations Impairing GSK3-Mediated MAF Phosphorylation Cause Cataract, Deafness, Intellectual Disability, Seizures, and a Down Syndrome-like Facies. (PMID: 25865493) Niceta M … Tartaglia M (American journal of human genetics 2015) 3 4 58
Products for MAF Gene
- R&D Systems Antibodies for MAF (c-Maf)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for MAF
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for MAF
- Origene Custom Protein Services for MAF
- Origene shrna, sirna, and RNAi products in human, mouse, rat for MAF
- Browse OriGene Inhibitory RNA Products For MAF
- OriGene qPCR primer pairs for MAF
- OriGene qPCR primer pairs and template standards for MAF
- OriGene CRISPR knockouts for MAF
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For MAF
- GenScript: Next-day shipping of latest version cDNA ORF clones for MAF in any vector
- GenScript Custom Purified and Recombinant Proteins Services for MAF
- GenScript Custom Assay Services for MAF
- GenScript Custom overexpressing Cell Line Services for MAF
- GenScript: Design CRISPR guide RNA sequences for MAF
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for MAF
- Sino Biological Human cDNA Clone for MAF
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Sino Biological Antibodies for MAF
- Browse Sino Biological Assays
- Browse Antibodies
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for MAF
- Novus Biologicals proteins for MAF
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for MAF
- Abcam proteins for MAF
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for MAF (AFLGC-MAF)
- Cyagen custom Knockout/knockin (KOKI) mouse models for MAF
- Addgene plasmids for MAF
- antibodies-online: Search results for 115 available MAF Antibodies ranked by validation data
- Compare Top MAF Antibodies
- Quality Products:
- antibodies-online: Search results for 19 available MAF Elisa Kits ranked by validation data
- Compare Top MAF Elisa Kits
- Quality Products:
- antibodies-online: Search results for 8 available MAF Proteins ranked by validation data
- Compare Top MAF Proteins
- Quality Products:
- GeneTex MAF Antibody for MAF
- Search GeneTex for Proteins for MAF
- Santa Cruz Biotechnology (SCBT) Antibodies for MAF
- Search Santa Cruz Biotechnology (SCBT) for MAF siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for MAF
- Horizon Cell Lines for MAF
- genomics-online: cdna clones - Search results for available MAF gene related products
- orf clones - Search results for available MAF gene related products
- genomics-online: gRNA clones - Search results for available MAF gene related products
- genomics-online: primer clones - Search results for available MAF gene related products
- genomics-online: shRNA clones - Search results for available MAF gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for MAF
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for MAF
- GeneCopoeia miRNA 3'UTR Target clone products for MAF
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MAF
Sources for MAF Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt