MAF Gene (Protein Coding)

MAF BZIP Transcription Factor

GC16M079212
GIFtS:
47
The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell devel... See more...

Aliases for MAF Gene

Aliases for MAF Gene

  • MAF BZIP Transcription Factor 2 3 5
  • V-Maf Avian Musculoaponeurotic Fibrosarcoma Oncogene Homolog 2 3
  • Transcription Factor Maf 3 4
  • Proto-Oncogene C-Maf 3 4
  • Avian Musculoaponeurotic Fibrosarcoma (MAF) Protooncogene 3
  • V-Maf Musculoaponeurotic Fibrosarcoma Oncogene Homolog 4
  • T Lymphocyte C-Maf Long Form 3
  • C-Maf Proto-Oncogene 3
  • CTRCT21 3
  • AYGRP 3
  • C-MAF 3
  • CCA4 3

External Ids for MAF Gene

Previous GeneCards Identifiers for MAF Gene

  • GC16M070559
  • GC16M080589
  • GC16M079366
  • GC16M079407
  • GC16M078185
  • GC16M079627
  • GC16M065384

Summaries for MAF Gene

Entrez Gene Summary for MAF Gene

  • The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]

GeneCards Summary for MAF Gene

MAF (MAF BZIP Transcription Factor) is a Protein Coding gene. Diseases associated with MAF include Ayme-Gripp Syndrome and Cataract 21, Multiple Types. Among its related pathways are Th17 cell differentiation and Tacrolimus/Cyclosporine Pathway, Pharmacodynamics. Gene Ontology (GO) annotations related to this gene include DNA-binding transcription factor activity and DNA-binding transcription activator activity, RNA polymerase II-specific. An important paralog of this gene is MAFB.

UniProtKB/Swiss-Prot Summary for MAF Gene

  • Acts as a transcriptional activator or repressor. Involved in embryonic lens fiber cell development. Recruits the transcriptional coactivators CREBBP and/or EP300 to crystallin promoters leading to up-regulation of crystallin gene during lens fiber cell differentiation. Activates the expression of IL4 in T helper 2 (Th2) cells. Increases T-cell susceptibility to apoptosis by interacting with MYB and decreasing BCL2 expression. Together with PAX6, transactivates strongly the glucagon gene promoter through the G1 element. Activates transcription of the CD13 proximal promoter in endothelial cells. Represses transcription of the CD13 promoter in early stages of myelopoiesis by affecting the ETS1 and MYB cooperative interaction. Involved in the initial chondrocyte terminal differentiation and the disappearance of hypertrophic chondrocytes during endochondral bone development. Binds to the sequence 5'-[GT]G[GC]N[GT]NCTCAGNN-3' in the L7 promoter. Binds to the T-MARE (Maf response element) sites of lens-specific alpha- and beta-crystallin gene promoters. Binds element G1 on the glucagon promoter. Binds an AT-rich region adjacent to the TGC motif (atypical Maf response element) in the CD13 proximal promoter in endothelial cells (By similarity). When overexpressed, represses anti-oxidant response element (ARE)-mediated transcription. Involved either as an oncogene or as a tumor suppressor, depending on the cell context. Binds to the ARE sites of detoxifying enzyme gene promoters.

Gene Wiki entry for MAF Gene

Additional gene information for MAF Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for MAF Gene

Genomics for MAF Gene

GeneHancer (GH) Regulatory Elements for MAF Gene

Promoters and enhancers for MAF Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH16J079591 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 763.4 +2.5 2505 13 FOXK2 ZNF785 SIN3A CTCF SREBF1 ZBTB6 FOXA1 CTBP1 USF2 NR2F1 MAF LINC01229 LOC101928230 ENSG00000277214 ENSG00000261472
GH16J079764 Promoter/Enhancer 2.1 FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 10.8 -168.0 -167960 9.1 SP1 ZBTB40 CTCF MLX TCF7L2 FOS CREB1 ZNF362 NFYC RAD21 LINC01229 MAF MAFTRR piR-38579-019
GH16J079380 Enhancer 0.9 FANTOM5 ENCODE CraniofacialAtlas 13.1 +219.3 219297 1.7 POLR2A STAT1 YY1 RCOR1 NR2F2 MAF HSALNG0112894 lnc-MAF-6
GH16J079372 Enhancer 0.9 FANTOM5 Ensembl ENCODE 12.5 +228.1 228085 1.8 FOSL2 ZIC2 DPF2 HSF1 FOS SMARCE1 HSALNG0112894 MAF lnc-MAF-6
GH16J079564 Enhancer 1 Ensembl ENCODE 11.3 +36.0 36016 1.9 MLX RBPJ NR2F1 NR2F6 MIXL1 HLF ZNF652 ELF3 SP1 TFE3 MAF ENSG00000261472
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MAF on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MAF gene promoter:
  • AP-1
  • ATF-2
  • c-Jun
  • E2F
  • E2F-1
  • E2F-3a
  • E2F-4

Genomic Locations for MAF Gene

Genomic Locations for MAF Gene
chr16:79,212,772-79,600,786
(GRCh38/hg38)
Size:
388,015 bases
Orientation:
Minus strand
chr16:79,619,740-79,634,622
(GRCh37/hg19)
Size:
14,883 bases
Orientation:
Minus strand

Genomic View for MAF Gene

Genes around MAF on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MAF Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MAF Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for MAF Gene

Proteins for MAF Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for MAF Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O75444-MAF_HUMAN
    Recommended name:
    Transcription factor Maf
    Protein Accession:
    O75444
    Secondary Accessions:
    • Q66I47
    • Q9UP93

    Protein attributes for MAF Gene

    Size:
    373 amino acids
    Molecular mass:
    38492 Da
    Quaternary structure:
    • Homodimer or heterodimer with other bHLH-Zip transcription factors. Binds DNA as a homodimer or as a heterodimer. Heterotetramer of two MAF and two USF2. Interacts with PAX6; the interaction is direct. Interacts with MYB; interaction takes place weakly in normal T-cells and increases in T-cells following stimulation through the TCR engagement. Interacts with MYB; the ternary complex formed with MYB and the CD13 promoter is regulated in response to differentiating signals. Interacts with USF2; the interaction inhibits its DNA-binding activity on the L7 promoter. Interacts with CREBBP, EP300 and ETS1 (By similarity).

    Alternative splice isoforms for MAF Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MAF Gene

Protein Expression for MAF Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for MAF Gene

  • Ubiquitinated, leading to its degradation by the proteasome. Ubiquitination is triggered by glucocorticoids.
  • Phosphorylated by GSK3 and MAPK13 on serine and threonine residues (Probable). The phosphorylation status can serve to either stimulate or inhibit transcription.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for MAF Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for MAF
  • Boster Bio Antibodies for MAF

No data available for DME Specific Peptides for MAF Gene

Domains & Families for MAF Gene

Gene Families for MAF Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for MAF Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for MAF Gene

GenScript: Design optimal peptide antigens:
  • V-maf musculoaponeurotic fibrosarcoma oncogene homolog (MAF_HUMAN)
  • C-maf proto-oncogene (Q71A33_HUMAN)

Graphical View of Domain Structure for InterPro Entry

O75444

UniProtKB/Swiss-Prot:

MAF_HUMAN :
  • Belongs to the bZIP family. Maf subfamily.
Family:
  • Belongs to the bZIP family. Maf subfamily.
genes like me logo Genes that share domains with MAF: view

Function for MAF Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for MAF Gene

UniProtKB/Swiss-Prot Function:
Acts as a transcriptional activator or repressor. Involved in embryonic lens fiber cell development. Recruits the transcriptional coactivators CREBBP and/or EP300 to crystallin promoters leading to up-regulation of crystallin gene during lens fiber cell differentiation. Activates the expression of IL4 in T helper 2 (Th2) cells. Increases T-cell susceptibility to apoptosis by interacting with MYB and decreasing BCL2 expression. Together with PAX6, transactivates strongly the glucagon gene promoter through the G1 element. Activates transcription of the CD13 proximal promoter in endothelial cells. Represses transcription of the CD13 promoter in early stages of myelopoiesis by affecting the ETS1 and MYB cooperative interaction. Involved in the initial chondrocyte terminal differentiation and the disappearance of hypertrophic chondrocytes during endochondral bone development. Binds to the sequence 5'-[GT]G[GC]N[GT]NCTCAGNN-3' in the L7 promoter. Binds to the T-MARE (Maf response element) sites of lens-specific alpha- and beta-crystallin gene promoters. Binds element G1 on the glucagon promoter. Binds an AT-rich region adjacent to the TGC motif (atypical Maf response element) in the CD13 proximal promoter in endothelial cells (By similarity). When overexpressed, represses anti-oxidant response element (ARE)-mediated transcription. Involved either as an oncogene or as a tumor suppressor, depending on the cell context. Binds to the ARE sites of detoxifying enzyme gene promoters.
UniProtKB/Swiss-Prot Induction:
Up-regulated with tert-butyl hydroquinone (t-BHQ).
GENATLAS Biochemistry:
avian musculoaponeurotic fibrosarcoma (v-maf) oncogene homolog

Phenotypes From GWAS Catalog for MAF Gene

Gene Ontology (GO) - Molecular Function for MAF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IBA 21873635
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific NAS 19274049
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific IEA --
GO:0003677 DNA binding IEA --
GO:0003700 DNA-binding transcription factor activity IBA 21873635
genes like me logo Genes that share ontologies with MAF: view
genes like me logo Genes that share phenotypes with MAF: view

Human Phenotype Ontology for MAF Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for MAF Gene

MGI Knock Outs for MAF:
  • Maf Maf<tm1Mym>
  • Maf Maf<tm1Glm>
  • Maf Maf<tm1Gsb>
  • Maf Maf<tm1.1Cbm>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MAF

Clone Products

  • Addgene plasmids for MAF

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for MAF Gene

Localization for MAF Gene

Subcellular locations from UniProtKB/Swiss-Prot for MAF Gene

Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MAF gene
Compartment Confidence
nucleus 4
cytosol 2
plasma membrane 1
extracellular 1
cytoskeleton 1
peroxisome 0

Gene Ontology (GO) - Cellular Components for MAF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000785 chromatin TAS 9616139
GO:0005634 nucleus IBA 21873635
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with MAF: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for MAF Gene

Pathways & Interactions for MAF Gene

genes like me logo Genes that share pathways with MAF: view

SIGNOR curated interactions for MAF Gene

Activates:
Inactivates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for MAF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0001816 cytokine production IEA --
GO:0002088 lens development in camera-type eye IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006366 transcription by RNA polymerase II TAS 9616139
genes like me logo Genes that share ontologies with MAF: view

Drugs & Compounds for MAF Gene

Products:

  1. Drug

(4) Drugs for MAF Gene - From: DrugBank and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Furan Approved, Experimental, Investigational Pharma Target 0
Deoxyuridine-5'-Triphosphate Experimental Pharma Target 0

(2) Additional Compounds for MAF Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with MAF: view

Transcripts for MAF Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for MAF Gene

(2) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(239) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for MAF

Clone Products

  • Addgene plasmids for MAF

Alternative Splicing Database (ASD) splice patterns (SP) for MAF Gene

No ASD Table

Relevant External Links for MAF Gene

GeneLoc Exon Structure for
MAF
ECgene alternative splicing isoforms for
MAF

Expression for MAF Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MAF Gene

mRNA expression in normal human tissues for MAF Gene
mRNA expression by BioGPS for MAF GenemRNA expression by GTEx for MAF Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for MAF Gene

This gene is overexpressed in Synovial fluid (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MAF Gene



Protein tissue co-expression partners for MAF Gene

NURSA nuclear receptor signaling pathways regulating expression of MAF Gene:

MAF

SOURCE GeneReport for Unigene cluster for MAF Gene:

Hs.134859

mRNA Expression by UniProt/SwissProt for MAF Gene:

O75444-MAF_HUMAN
Tissue specificity: Expressed in endothelial cells.

Evidence on tissue expression from TISSUES for MAF Gene

  • Kidney(3.6)
  • Liver(2.8)
  • Muscle(2.8)
  • Nervous system(2.8)
  • Blood(2.6)
  • Intestine(2.6)
  • Spleen(2.5)
  • Pancreas(2.4)
  • Skin(2.4)
  • Eye(2.3)
  • Lymph node(2.2)
  • Bone marrow(2.1)
  • Lung(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for MAF Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • digestive
  • integumentary
  • nervous
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cheek
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • nose
  • outer ear
  • skull
Limb:
  • arm
  • forearm
  • radius
  • ulna
  • upper limb
General:
  • hair
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with MAF: view

No data available for mRNA differential expression in normal tissues for MAF Gene

Orthologs for MAF Gene

This gene was present in the common ancestor of animals.

Orthologs for MAF Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia MAF 33 32
  • 99.73 (n)
 OneToOne
mouse
(Mus musculus)
 Mammalia Maf 17 33 32
  • 93.24 (n)
cow
(Bos Taurus)
 Mammalia MAF 33 32
  • 92.4 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Maf 32
  • 91.87 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia MAF 33
  • 88 (a)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia MAF 33
  • 84 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves MAF 33
  • 88 (a)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia MAF 33
  • 69 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia Str.15477 32
zebrafish
(Danio rerio)
 Actinopterygii maf 33 32
  • 80 (a)
 OneToOne
fruit fly
(Drosophila melanogaster)
 Insecta tj 33
  • 22 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea maf-1 33
  • 31 (a)
 OneToMany
sea squirt
(Ciona savignyi)
 Ascidiacea -- 33
  • 25 (a)
 ManyToMany
Species where no ortholog for MAF was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for MAF Gene

ENSEMBL:
Gene Tree for MAF (if available)
TreeFam:
Gene Tree for MAF (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MAF: view image

Paralogs for MAF Gene

Paralogs for MAF Gene

(6) SIMAP similar genes for MAF Gene using alignment to 3 proteins:

  • MAF_HUMAN
  • H3BP11_HUMAN
  • Q71A33_HUMAN
genes like me logo Genes that share paralogs with MAF: view

Variants for MAF Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for MAF Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1057518878 likely-pathogenic, Congenital cataract 79,599,715(-) G/C coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs1060502729 uncertain-significance, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12 79,211,713(-) G/C 3_prime_UTR_variant, genic_downstream_transcript_variant, non_coding_transcript_variant
rs1064792969 uncertain-significance, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12 79,211,729(-) CGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC/C 3_prime_UTR_variant, genic_downstream_transcript_variant, non_coding_transcript_variant
rs1064793798 pathogenic, uncertain-significance, not provided, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12 79,211,666(-) G/A/C 3_prime_UTR_variant, genic_downstream_transcript_variant, non_coding_transcript_variant
rs117065412 benign, uncertain-significance, Epileptic encephalopathy, early infantile, 1, Spinocerebellar ataxia, autosomal recessive 12, not specified, not provided 79,211,789(-) C/A/G 3_prime_UTR_variant, genic_downstream_transcript_variant, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MAF Gene

Variant ID Type Subtype PubMed ID
esv2672388 CNV deletion 23128226
nsv1071298 CNV deletion 25765185
nsv573285 CNV gain 21841781
nsv573289 CNV loss 21841781
nsv819930 CNV gain 19587683
nsv827768 CNV gain 20364138
nsv827769 CNV gain 20364138
nsv833295 CNV gain 17160897

Variation tolerance for MAF Gene

Residual Variation Intolerance Score: 29.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.97; 20.09% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MAF Gene

Human Gene Mutation Database (HGMD)
MAF
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MAF

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MAF Gene

Disorders for MAF Gene

MalaCards: The human disease database

(22) MalaCards diseases for MAF Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
ayme-gripp syndrome
  • aygrp
cataract 21, multiple types
  • ctrct21
cerulean cataract
  • cca1
cataract microcornea syndrome
  • microcornea cataract syndrome
cataract 30, multiple types
  • ctrct30
- elite association - COSMIC cancer census association via MalaCards
Search MAF in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

MAF_HUMAN
  • Note=A chromosomal aberration involving MAF is found in some forms of multiple myeloma (MM). Translocation t(14;16)(q32.3;q23) with an IgH locus.
  • Cataract 21, multiple types (CTRCT21) [MIM:610202]: An opacification of the crystalline lens of the eye that frequently results in visual impairment or blindness. Opacities vary in morphology, are often confined to a portion of the lens, and may be static or progressive. In general, the more posteriorly located and dense an opacity, the greater the impact on visual function. CTRCT21 includes cerulean and pulverulent cataracts. Cerulean cataracts are characterized by peripheral bluish and white opacifications organized in concentric layers with occasional central lesions arranged radially. The opacities are observed in the superficial layers of the fetal nucleus as well as the adult nucleus of the lens. Involvement is usually bilateral. Visual acuity is only mildly reduced in childhood. In adulthood, the opacifications may progress, making lens extraction necessary. Histologically the lesions are described as fusiform cavities between lens fibers which contain a deeply staining granular material. Although the lesions may take on various colors, a dull blue is the most common appearance and is responsible for the designation cerulean cataract. Pulverulent cataracts are characterized by a dust-like, 'pulverised' appearance of the opacities which can be found in any part of the lens. In some cases cataract is associated with microcornea without any other systemic anomaly or dysmorphism. Microcornea is defined by a corneal diameter inferior to 10 mm in both meridians in an otherwise normal eye. {ECO:0000269 PubMed:11772997, ECO:0000269 PubMed:16470690, ECO:0000269 PubMed:24664492}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Ayme-Gripp syndrome (AYGRP) [MIM:601088]: A multisystem disorder characterized by congenital cataracts, sensorineural deafness, intellectual disability, seizures, brachycephaly, distinctive flat facial appearance, skeletal anomalies, mammary gland hypoplasia, and reduced growth. {ECO:0000269 PubMed:25865493}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for MAF

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
Tumor Gene Database
(TGDB)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MAF: view

No data available for Genatlas for MAF Gene

Publications for MAF Gene

  1. CD13/APN transcription is regulated by the proto-oncogene c-Maf via an atypical response element. (PMID: 17897790) Mahoney KM … Shapiro LH (Gene 2007) 3 4 23 56
  2. A novel mutation in the DNA-binding domain of MAF at 16q23.1 associated with autosomal dominant "cerulean cataract" in an Indian family. (PMID: 16470690) Vanita V … Singh JR (American journal of medical genetics. Part A 2006) 3 4 23 56
  3. Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma. (PMID: 11772997) Jamieson RV … Black GC (Human molecular genetics 2002) 3 4 23 56
  4. c-Maf negatively regulates ARE-mediated detoxifying enzyme genes expression and anti-oxidant induction. (PMID: 12149651) Dhakshinamoorthy S … Jaiswal AK (Oncogene 2002) 3 4 23 56
  5. Mutations Impairing GSK3-Mediated MAF Phosphorylation Cause Cataract, Deafness, Intellectual Disability, Seizures, and a Down Syndrome-like Facies. (PMID: 25865493) Niceta M … Tartaglia M (American journal of human genetics 2015) 3 4 56

ExternalLinks

View latest publications for MAF gene in Mastermind

Products for MAF Gene

  • Addgene plasmids for MAF
  • Boster Bio Antibodies for MAF
  • Boster Bio ELISA Kits for MAF

Sources for MAF Gene