Aliases for LOC105377731 Gene

Subcategory (RNA class) for LOC105377731 Gene


Quality Score for this RNA gene is


Aliases for LOC105377731 Gene

  • Uncharacterized LOC105377731 3

External Ids for LOC105377731 Gene

Previous GeneCards Identifiers for LOC105377731 Gene

  • GC05U902461

Summaries for LOC105377731 Gene

GeneCards Summary for LOC105377731 Gene

LOC105377731 (Uncharacterized LOC105377731) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105377731 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for LOC105377731 Gene

Genomics for LOC105377731 Gene

GeneHancer (GH) Regulatory Elements for LOC105377731 Gene

Promoters and enhancers for LOC105377731 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J173265 Enhancer 1.3 VISTA FANTOM5 Ensembl dbSUPER 750.6 -1.8 -1849 4.8 HLF MAFK CEBPG CEBPA TRIM24 ATF3 CEBPB NFIL3 TCF12 TAL1 LOC105377731 NKX2-5 lnc-NKX2-5-3
GH05J173271 Enhancer 0.4 Ensembl dbSUPER 750.6 +2.0 1970 1.2 NFXL1 LOC105377731 lnc-BNIP1-1
GH05J173278 Enhancer 0.6 VISTA dbSUPER 0.4 +10.3 10336 2.9 ZNF133 SCRT2 ADNP ZMYM3 ENSG00000204758 ENSG00000254295 RPL26L1 RNU6-500P UBTD2 lnc-BNIP1-1 LOC105377731 RNA5SP200
GH05J173263 Enhancer 0.3 dbSUPER 0.4 -5.7 -5702 0.6 ZNF121 LOC105377731 lnc-NKX2-5-3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105377731 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105377731 Gene

Genomic Locations for LOC105377731 Gene
11,499 bases
Plus strand

Genomic View for LOC105377731 Gene

Genes around LOC105377731 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105377731 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105377731 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105377731 Gene

Proteins for LOC105377731 Gene

Post-translational modifications for LOC105377731 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105377731 Gene

Domains & Families for LOC105377731 Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for LOC105377731 Gene

Function for LOC105377731 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105377731 Gene

Localization for LOC105377731 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105377731 Gene

Pathways & Interactions for LOC105377731 Gene

PathCards logo

SuperPathways for LOC105377731 Gene

No Data Available

Gene Ontology (GO) - Biological Process for LOC105377731 Gene


No data available for Pathways by source and SIGNOR curated interactions for LOC105377731 Gene

Drugs & Compounds for LOC105377731 Gene

No Compound Related Data Available

Transcripts for LOC105377731 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105377731 Gene

No ASD Table

Relevant External Links for LOC105377731 Gene

GeneLoc Exon Structure for

No data available for mRNA/cDNA for LOC105377731 Gene

Expression for LOC105377731 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105377731 Gene

Orthologs for LOC105377731 Gene

No data available for Orthologs and Evolution for LOC105377731 Gene

Paralogs for LOC105377731 Gene

No data available for Paralogs for LOC105377731 Gene

Variants for LOC105377731 Gene

Sequence variations from dbSNP and Humsavar for LOC105377731 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1000304408 -- 173,276,575(+) C/T intron_variant
rs1000393858 -- 173,268,147(+) C/A/T upstream_transcript_variant
rs1000483662 -- 173,270,085(+) T/C intron_variant
rs1000491359 -- 173,281,798(+) AACTATGAATAATTTTTAAGATTACAA/A intron_variant
rs1000571073 -- 173,295,176(+) G/T intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105377731 Gene

Disorders for LOC105377731 Gene

No disorders were found for LOC105377731 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105377731 Gene

Publications for LOC105377731 Gene

No publications were found for LOC105377731 Gene.

No data available for External Links for LOC105377731 Gene

Products for LOC105377731 Gene

Sources for LOC105377731 Gene