Aliases for LOC105376420 Gene

Subcategory (RNA class) for LOC105376420 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC105376420 Gene

  • Uncharacterized LOC105376420 3

External Ids for LOC105376420 Gene

Previous GeneCards Identifiers for LOC105376420 Gene

  • GC10U902115

Summaries for LOC105376420 Gene

GeneCards Summary for LOC105376420 Gene

LOC105376420 (Uncharacterized LOC105376420) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105376420 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for LOC105376420 Gene

Genomics for LOC105376420 Gene

GeneHancer (GH) Regulatory Elements for LOC105376420 Gene

Promoters and enhancers for LOC105376420 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH10J013414 Enhancer 1 ENCODE dbSUPER 750.6 +1.3 1302 0.3 CTCF MLX MIXL1 DACH1 TEAD4 ELF3 CBFA2T2 PPARG ZNF644 KAT8 ENSG00000233256 LOC105376420 RF00017-594
GH10J013417 Enhancer 1 Ensembl dbSUPER 0.6 +3.9 3925 0.2 SMARCE1 RUNX1 L3MBTL2 TEAD4 ZC3H8 ZKSCAN8 GTF2F1 ZFX MLLT1 SMARCA4 ENSG00000233256 LOC105376420 RF00017-594 lnc-PRPF18-13
GH10J013403 Enhancer 1.3 Ensembl ENCODE dbSUPER 0.4 -9.3 -9275 1.8 SMARCE1 CC2D1A ELF1 DACH1 TEAD4 ZNF148 GTF2F1 CSDE1 CBFA2T2 NCOA6 ENSG00000239665 PRPF18 BTBD7P1 SEPHS1 ENSG00000273474 LOC105376420 ENSG00000286514 LOC105376419
GH10J013395 Enhancer 0.4 ENCODE 0.4 -18.0 -18030 0.2 POU5F1 SP1 NANOG SEPHS1 ENSG00000286514 lnc-MCM10-1 LOC105376419 LOC105376420
GH10J013400 Enhancer 0.2 ENCODE 0.4 -13.0 -13020 0.2 ENSG00000286514 LOC105376420 LOC105376419
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105376420 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105376420 Gene

Genomic Locations for LOC105376420 Gene
chr10:13,413,776-13,423,758
(GRCh38/hg38)
Size:
9,983 bases
Orientation:
Plus strand

Genomic View for LOC105376420 Gene

Genes around LOC105376420 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105376420 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105376420 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105376420 Gene

Proteins for LOC105376420 Gene

Post-translational modifications for LOC105376420 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105376420 Gene

Domains & Families for LOC105376420 Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for LOC105376420 Gene

Function for LOC105376420 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105376420 Gene

Localization for LOC105376420 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105376420 Gene

Pathways & Interactions for LOC105376420 Gene

PathCards logo

SuperPathways for LOC105376420 Gene

No Data Available

Gene Ontology (GO) - Biological Process for LOC105376420 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105376420 Gene

Drugs & Compounds for LOC105376420 Gene

No Compound Related Data Available

Transcripts for LOC105376420 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105376420 Gene

No ASD Table

Relevant External Links for LOC105376420 Gene

GeneLoc Exon Structure for
LOC105376420

No data available for mRNA/cDNA for LOC105376420 Gene

Expression for LOC105376420 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105376420 Gene

Orthologs for LOC105376420 Gene

No data available for Orthologs and Evolution for LOC105376420 Gene

Paralogs for LOC105376420 Gene

No data available for Paralogs for LOC105376420 Gene

Variants for LOC105376420 Gene

Sequence variations from dbSNP and Humsavar for LOC105376420 Gene

SNP ID Clin Chr 10 pos Variation AA Info Type
rs1000192781 -- 13,422,661(+) T/C intron_variant
rs1000347119 -- 13,413,443(+) CAACAAATGACTGT/CAACAAATGACTGTCAACAAATGACTGT non_coding_transcript_variant
rs1000693181 -- 13,414,022(+) C/G/T non_coding_transcript_variant
rs1001045220 -- 13,415,471(+) G/A intron_variant
rs1001201005 -- 13,414,238(+) A/T intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105376420 Gene

Disorders for LOC105376420 Gene

No disorders were found for LOC105376420 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105376420 Gene

Publications for LOC105376420 Gene

No publications were found for LOC105376420 Gene.

No data available for External Links for LOC105376420 Gene

Products for LOC105376420 Gene

Sources for LOC105376420 Gene