Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105375403 Gene

Subcategory (RNA class) for LOC105375403 Gene

ncRNA

Quality Score for this RNA gene is

2

Aliases for LOC105375403 Gene

  • Uncharacterized LOC105375403 3
  • AC006378.1 5

External Ids for LOC105375403 Gene

Previous GeneCards Identifiers for LOC105375403 Gene

  • GC07U904319

Summaries for LOC105375403 Gene

GeneCards Summary for LOC105375403 Gene

LOC105375403 (Uncharacterized LOC105375403) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105375403 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105375403 Gene

Genomics for LOC105375403 Gene

GeneHancer (GH) Regulatory Elements for LOC105375403 Gene

Promoters and enhancers for LOC105375403 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07I093231 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 29.5 -733.9 -733888 2.1 PKNOX1 SMAD1 FOXA2 ARNT ARID4B SIN3A ZNF2 YY1 POLR2B ZNF766 VPS50 HEPACAM2 KRIT1 LOC105375403 PEX1 SAMD9L GATAD1 FAM133B BET1
GH07I094942 Enhancer 0.8 ENCODE 28.7 +976.5 976494 0.6 FOXA2 ZNF529 ZFP64 ZBTB40 ZNF213 ZNF302 ZNF354C ZNF138 ZNF202 ZNF680 RPS3AP25 CASD1 SGCE LOC105375403 BET1 COL1A2 DYNC1I1 PPP1R9A PIR34756 GC07M095019
GH07I093145 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE 11.7 -818.8 -818763 3.6 PKNOX1 ATF1 ZBTB40 ZNF766 RUNX3 CAVIN1 ZBTB11 ZNF592 ZNF148 MEF2D SAMD9L ENSG00000243107 KRIT1 GATAD1 PEX1 FAM133B BET1 LOC105375403 VPS50 GC07P093141
GH07I094641 Enhancer 0.4 ENCODE 13.2 +675.2 675153 0.3 BACH1 NFE2 ZNF214 LOC105375403 SGCE CASD1 PON3 LOC105375404
GH07I094354 Enhancer 0.6 ENCODE dbSUPER 5.1 +389.5 389501 1.9 JUND POLR2A MAFK LOC105375403 GC07P094390 GC07M094231 COL1A2-AS1 GC07P094145
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LOC105375403 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105375403 Gene

Genomic Locations for LOC105375403 Gene
chr7:93,966,033-94,011,113
(GRCh38/hg38)
Size:
45,081 bases
Orientation:
Plus strand
chr7:93,598,754-93,640,425
(GRCh37/hg19)

Genomic View for LOC105375403 Gene

Genes around LOC105375403 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105375403 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105375403 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105375403 Gene

Proteins for LOC105375403 Gene

Post-translational modifications for LOC105375403 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105375403 Gene

Domains & Families for LOC105375403 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105375403 Gene

Function for LOC105375403 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105375403 Gene

Localization for LOC105375403 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105375403 Gene

Pathways & Interactions for LOC105375403 Gene

SuperPathways for LOC105375403 Gene

No Data Available

Interacting Proteins for LOC105375403 Gene

Gene Ontology (GO) - Biological Process for LOC105375403 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105375403 Gene

Drugs & Compounds for LOC105375403 Gene

No Compound Related Data Available

Transcripts for LOC105375403 Gene

mRNA/cDNA for LOC105375403 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105375403 Gene

No ASD Table

Relevant External Links for LOC105375403 Gene

GeneLoc Exon Structure for
LOC105375403

Expression for LOC105375403 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105375403 Gene

Orthologs for LOC105375403 Gene

Evolution for LOC105375403 Gene

ENSEMBL:
Gene Tree for LOC105375403 (if available)
TreeFam:
Gene Tree for LOC105375403 (if available)

No data available for Orthologs for LOC105375403 Gene

Paralogs for LOC105375403 Gene

No data available for Paralogs for LOC105375403 Gene

Variants for LOC105375403 Gene

Sequence variations from dbSNP and Humsavar for LOC105375403 Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs1000602234 -- 93,983,307(+) C/T intron_variant
rs1000697052 -- 93,978,040(+) T/C intron_variant
rs1000741519 -- 93,984,265(+) A/G intron_variant
rs1000959072 -- 93,969,523(+) TAGATGCTGGACTTTTCCCCTAGATGCTGGACTTTTCCCCTAG/TAGATGCTGGACTTTTCCCCTAG upstream_transcript_variant
rs1000993344 -- 93,976,175(+) T/A intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105375403 Gene

Disorders for LOC105375403 Gene

No disorders were found for LOC105375403 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105375403 Gene

Publications for LOC105375403 Gene

No publications were found for LOC105375403 Gene.

Products for LOC105375403 Gene

Sources for LOC105375403 Gene

Content
Loading form....