Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105375102 Gene

Subcategory (RNA class) for LOC105375102 Gene


Quality Score for this RNA gene is


Aliases for LOC105375102 Gene

  • Uncharacterized LOC105375102 3

External Ids for LOC105375102 Gene

Previous GeneCards Identifiers for LOC105375102 Gene

  • GC06U902709

Summaries for LOC105375102 Gene

GeneCards Summary for LOC105375102 Gene

LOC105375102 (Uncharacterized LOC105375102) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105375102 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105375102 Gene

Genomics for LOC105375102 Gene

GeneHancer (GH) Regulatory Elements for LOC105375102 Gene

Promoters and enhancers for LOC105375102 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J057813 Enhancer 0.2 Ensembl 0.4 +9.0 8971 0.9 LOC105375101 LOC105375102 TRI-AAT1-1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LOC105375102 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105375102 Gene

Genomic Locations for LOC105375102 Gene
11,480 bases
Minus strand

Genomic View for LOC105375102 Gene

Genes around LOC105375102 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105375102 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105375102 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105375102 Gene

Proteins for LOC105375102 Gene

Post-translational modifications for LOC105375102 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105375102 Gene

Domains & Families for LOC105375102 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105375102 Gene

Function for LOC105375102 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105375102 Gene

Localization for LOC105375102 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105375102 Gene

Pathways & Interactions for LOC105375102 Gene

SuperPathways for LOC105375102 Gene

No Data Available

Interacting Proteins for LOC105375102 Gene

Gene Ontology (GO) - Biological Process for LOC105375102 Gene


No data available for Pathways by source and SIGNOR curated interactions for LOC105375102 Gene

Drugs & Compounds for LOC105375102 Gene

No Compound Related Data Available

Transcripts for LOC105375102 Gene

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105375102 Gene

No ASD Table

Relevant External Links for LOC105375102 Gene

GeneLoc Exon Structure for

No data available for mRNA/cDNA for LOC105375102 Gene

Expression for LOC105375102 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105375102 Gene

Orthologs for LOC105375102 Gene

No data available for Orthologs and Evolution for LOC105375102 Gene

Paralogs for LOC105375102 Gene

No data available for Paralogs for LOC105375102 Gene

Variants for LOC105375102 Gene

Sequence variations from dbSNP and Humsavar for LOC105375102 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000236775 -- 57,823,799(-) C/G upstream_transcript_variant
rs1001667866 -- 57,823,470(-) T/A upstream_transcript_variant
rs1004179356 -- 57,822,943(-) AAGAGAGGTAGGGTCCGTTCCCCCCGGCGG/ upstream_transcript_variant
rs1006020144 -- 57,824,539(-) G/T upstream_transcript_variant
rs1007299949 -- 57,824,012(-) T/C upstream_transcript_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105375102 Gene

Disorders for LOC105375102 Gene

No disorders were found for LOC105375102 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105375102 Gene

Publications for LOC105375102 Gene

No publications were found for LOC105375102 Gene.

Products for LOC105375102 Gene

Sources for LOC105375102 Gene

Loading form....