Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105374355 Gene

Subcategory (RNA class) for LOC105374355 Gene


Quality Score for this RNA gene is


Aliases for LOC105374355 Gene

  • Uncharacterized LOC105374355 3

External Ids for LOC105374355 Gene

Previous GeneCards Identifiers for LOC105374355 Gene

  • GC04U901992

Summaries for LOC105374355 Gene

GeneCards Summary for LOC105374355 Gene

LOC105374355 (Uncharacterized LOC105374355) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105374355 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105374355 Gene

Genomics for LOC105374355 Gene

GeneHancer (GH) Regulatory Elements for LOC105374355 Gene

Promoters and enhancers for LOC105374355 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH04I003472 Enhancer 0.4 dbSUPER 0.8 +3.2 3240 1.9 RING1 RFX1 ZSCAN29 NOP14-AS1 FAM193A ZBTB49 LINC00955 LRPAP1 DOK7 LOC105374355 GC04P003463
GH04I003470 Enhancer 0.7 ENCODE dbSUPER 0.4 +5.6 5611 0.1 NFIC NFIB ZNF10 SCRT2 ZBTB40 ZBTB20 LRPAP1 GC04P003463 DOK7 LOC105374355
GH04I003467 Enhancer 0.5 dbSUPER 0.4 +8.7 8704 0.7 CREB1 ATF7 ZBTB33 MNT ATF2 ZEB1 DOK7 GC04P003463 LOC105374355
GH04I003466 Enhancer 0.5 dbSUPER 0.4 +9.9 9927 1.7 CTCF ESRRA RFX1 EGR1 ZNF143 RAD21 DOK7 GC04P003463 LOC105374355
GH04I003469 Enhancer 0.5 dbSUPER 0.4 +6.3 6309 1.1 NFIC NFIB ZFP64 ZBTB40 RARA ZBTB20 LRPAP1 MSANTD1 DOK7 GC04P003463 LOC105374355
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LOC105374355 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105374355 Gene

Genomic Locations for LOC105374355 Gene
1,453 bases
Minus strand

Genomic View for LOC105374355 Gene

Genes around LOC105374355 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105374355 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105374355 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105374355 Gene

Proteins for LOC105374355 Gene

Post-translational modifications for LOC105374355 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105374355 Gene

Domains & Families for LOC105374355 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105374355 Gene

Function for LOC105374355 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105374355 Gene

Localization for LOC105374355 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105374355 Gene

Pathways & Interactions for LOC105374355 Gene

SuperPathways for LOC105374355 Gene

No Data Available

Interacting Proteins for LOC105374355 Gene

Gene Ontology (GO) - Biological Process for LOC105374355 Gene


No data available for Pathways by source and SIGNOR curated interactions for LOC105374355 Gene

Drugs & Compounds for LOC105374355 Gene

No Compound Related Data Available

Transcripts for LOC105374355 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105374355 Gene

No ASD Table

Relevant External Links for LOC105374355 Gene

GeneLoc Exon Structure for

No data available for mRNA/cDNA for LOC105374355 Gene

Expression for LOC105374355 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105374355 Gene

Orthologs for LOC105374355 Gene

No data available for Orthologs and Evolution for LOC105374355 Gene

Paralogs for LOC105374355 Gene

No data available for Paralogs for LOC105374355 Gene

Variants for LOC105374355 Gene

Sequence variations from dbSNP and Humsavar for LOC105374355 Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs199578351 conflicting-interpretations-of-pathogenicity, benign, not specified, Myasthenia, limb-girdle, familial, Pena-Shokeir syndrome type I 3,476,338(-) G/A upstream_transcript_variant
rs775583136 likely-pathogenic, not provided 3,476,523(-) C/A/T upstream_transcript_variant
rs200487431 likely-benign, not specified 3,476,560(-) G/A upstream_transcript_variant
rs781466203 likely-benign, not specified 3,476,299(-) ACCCTGCCCGCCCGTGATGCCCTCTT/ upstream_transcript_variant
rs114112298 benign, not specified 3,476,293(-) C/G/T upstream_transcript_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105374355 Gene

Disorders for LOC105374355 Gene

No disorders were found for LOC105374355 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105374355 Gene

Publications for LOC105374355 Gene

No publications were found for LOC105374355 Gene.

Products for LOC105374355 Gene

Sources for LOC105374355 Gene

Loading form....