Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105372457 Gene

Subcategory (RNA class) for LOC105372457 Gene

ncRNA

Quality Score for this RNA gene is

2

Aliases for LOC105372457 Gene

  • Uncharacterized LOC105372457 3
  • AC008440.1 5

External Ids for LOC105372457 Gene

Previous GeneCards Identifiers for LOC105372457 Gene

  • GC19U902065

Summaries for LOC105372457 Gene

GeneCards Summary for LOC105372457 Gene

LOC105372457 (Uncharacterized LOC105372457) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105372457 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105372457 Gene

Genomics for LOC105372457 Gene

GeneHancer (GH) Regulatory Elements for LOC105372457 Gene

Promoters and enhancers for LOC105372457 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I053864 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 550.8 +0.8 807 9.8 HDGF FOXA2 MLX ZFP64 ARID4B NEUROD1 SIN3A DMAP1 ZBTB7B SLC30A9 MYADM LOC105372457 ENSG00000269001 ZNF845 ZNF765 ZNF816 LENG8 ENSG00000235681 ZNF813 TPM3P6
GH19I054199 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 9.8 -336.0 -335989 12.1 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 RPS9 PRPF31 LENG8 LENG8-AS1 CNOT3 ZNF525 ZNF845 ENSG00000235681 LILRB5 ZNF765
GH19I054114 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 9.8 -245.5 -245490 2.4 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC PRPF31 GC19P054117 GC19P054118 TFPT PIR52942 LENG8-AS1 ZNF765 CNOT3 LENG8 ZNF845
GH19I053466 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 9.8 +401.8 401830 1.8 PKNOX1 ATF1 ARID4B DMAP1 SLC30A9 POLR2B E2F8 ATF7 SP3 SP5 ZNF813 CNOT3 ZNF701 ZNF600 LENG8 ZNF845 ZNF808 ENSG00000269001 ENSG00000268970 ZNF160
GH19I053393 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 9.8 +474.5 474536 2.4 ATF1 FOXA2 ARID4B SIN3A POLR2B GLIS2 E2F8 ELK1 ZNF143 ATF7 ZNF765 ZNF525 CNOT3 ZNF701 ZNF600 ZNF845 TPM3P6 ZNF808 ENSG00000269001 ZNF160
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LOC105372457 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105372457 Gene

Genomic Locations for LOC105372457 Gene
chr19:53,853,560-53,869,721
(GRCh38/hg38)
Size:
16,162 bases
Orientation:
Minus strand
chr19:54,357,835-54,372,361
(GRCh37/hg19)

Genomic View for LOC105372457 Gene

Genes around LOC105372457 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105372457 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105372457 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105372457 Gene

Proteins for LOC105372457 Gene

Post-translational modifications for LOC105372457 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105372457 Gene

Domains & Families for LOC105372457 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105372457 Gene

Function for LOC105372457 Gene

Phenotypes From GWAS Catalog for LOC105372457 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105372457 Gene

Localization for LOC105372457 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105372457 Gene

Pathways & Interactions for LOC105372457 Gene

SuperPathways for LOC105372457 Gene

No Data Available

Interacting Proteins for LOC105372457 Gene

Gene Ontology (GO) - Biological Process for LOC105372457 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105372457 Gene

Drugs & Compounds for LOC105372457 Gene

No Compound Related Data Available

Transcripts for LOC105372457 Gene

mRNA/cDNA for LOC105372457 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105372457 Gene

No ASD Table

Relevant External Links for LOC105372457 Gene

GeneLoc Exon Structure for
LOC105372457

Expression for LOC105372457 Gene

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105372457 Gene

Orthologs for LOC105372457 Gene

Evolution for LOC105372457 Gene

ENSEMBL:
Gene Tree for LOC105372457 (if available)
TreeFam:
Gene Tree for LOC105372457 (if available)

No data available for Orthologs for LOC105372457 Gene

Paralogs for LOC105372457 Gene

No data available for Paralogs for LOC105372457 Gene

Variants for LOC105372457 Gene

Sequence variations from dbSNP and Humsavar for LOC105372457 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000084182 -- 53,870,496(-) A/ATAGGA upstream_transcript_variant
rs1000331964 -- 53,864,935(-) A/G intron_variant
rs1000896591 -- 53,860,017(-) CTGTGATCACGCCACTGTGATCACGCC/CTGTGATCACGCC intron_variant
rs1001029539 -- 53,858,899(-) C/G intron_variant
rs1001063307 -- 53,865,696(-) A/G intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105372457 Gene

Disorders for LOC105372457 Gene

Additional Disease Information for LOC105372457

No disorders were found for LOC105372457 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LOC105372457 Gene

Publications for LOC105372457 Gene

No publications were found for LOC105372457 Gene.

Products for LOC105372457 Gene

Sources for LOC105372457 Gene

Content
Loading form....