Aliases for LOC105371841 Gene
Subcategory (RNA class) for LOC105371841 Gene
ncRNA
Quality Score for this RNA gene is
13
Aliases for LOC105371841 Gene
- Uncharacterized LOC105371841 3
External Ids for LOC105371841 Gene
- Entrez Gene: 105371841
Previous GeneCards Identifiers for LOC105371841 Gene
- GC17U902165
Summaries for LOC105371841 Gene
GeneCards Summary for LOC105371841 Gene
LOC105371841 (Uncharacterized LOC105371841) is an RNA Gene, and is affiliated with the ncRNA class. Diseases associated with LOC105371841 include Joubert Syndrome 28 and Bardet-Biedl Syndrome 13.
Additional gene information for LOC105371841 Gene
No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for LOC105371841 Gene
Genomics for LOC105371841 Gene
GeneHancer (GH) Regulatory Elements for LOC105371841 Gene
Promoters and enhancers for LOC105371841 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around LOC105371841 on UCSC Golden Path with GeneCards custom track
Genomic Locations for LOC105371841 Gene
Genomic Locations for LOC105371841 Gene
- chr17:58,219,980-58,233,553
- (GRCh38/hg38)
- Size:
- 13,574 bases
- Orientation:
- Plus strand
Genomic View for LOC105371841 Gene
Genes around LOC105371841 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 17q22 by Entrez Gene
LOC105371841 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for LOC105371841 Gene
Proteins for LOC105371841 Gene
Post-translational modifications for LOC105371841 Gene
No Post-translational modifications
Antibody Products
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for LOC105371841
- Origene Custom Protein Services for LOC105371841
No data available for DME Specific Peptides for LOC105371841 Gene
Domains & Families for LOC105371841 Gene
No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for LOC105371841 Gene
Function for LOC105371841 Gene
Phenotypes From GWAS Catalog for LOC105371841 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
miRNA Products
Inhibitory RNA Products
Clone Products
No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105371841 Gene
Localization for LOC105371841 Gene
No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105371841 Gene
Transcripts for LOC105371841 Gene
miRNA Products
Inhibitory RNA Products
Clone Products
Relevant External Links for LOC105371841 Gene
- GeneLoc Exon Structure for
- LOC105371841
No data available for mRNA/cDNA for LOC105371841 Gene
Expression for LOC105371841 Gene
No Expression Related Data Available
Primer Products
No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105371841 Gene
Orthologs for LOC105371841 Gene
No data available for Orthologs and Evolution for LOC105371841 Gene
Paralogs for LOC105371841 Gene
No data available for Paralogs for LOC105371841 Gene
Variants for LOC105371841 Gene
| SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1031187314 | uncertain-significance, Joubert syndrome, Meckel-Gruber syndrome | 58,219,167(+) | G/A/T | upstream_transcript_variant | |
| rs116514023 | benign, uncertain-significance, not specified, Meckel-Gruber syndrome, Bardet-Biedl syndrome | 58,219,248(+) | G/C | upstream_transcript_variant | |
| rs1244307754 | uncertain-significance, Bardet-Biedl syndrome 13, Joubert syndrome 28, Meckel syndrome type 1 | 58,219,242(+) | CGCGCCGCGACTGCGCCGGAAAGCGCGCCGC/CGCGCCGC | upstream_transcript_variant | |
| rs1311306088 | uncertain-significance, Joubert syndrome, Meckel-Gruber syndrome | 58,218,682(+) | G/A/C | upstream_transcript_variant | |
| rs1555601787 | likely-pathogenic, Bardet-Biedl syndrome 13, Joubert syndrome 28, Meckel syndrome type 1 | 58,219,230(+) | T/C | upstream_transcript_variant |
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105371841 Gene
Disorders for LOC105371841 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| joubert syndrome 28 |
|
|
| bardet-biedl syndrome 13 |
|
|
| meckel syndrome, type 1 |
|
|
| bardet-biedl syndrome |
|
|
Search LOC105371841 in MalaCards
View complete list of genes associated with diseases
No data available for UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105371841 Gene
Publications for LOC105371841 Gene
No publications were found for LOC105371841 Gene.
No data available for External Links for LOC105371841 Gene
Products for LOC105371841 Gene
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for LOC105371841
- Origene Custom Protein Services for LOC105371841
- Browse OriGene Inhibitory RNA Products For LOC105371841
- Browse OriGene qPCR primer pairs and template standards
- Browse CRISPR knockouts for LOC105371841
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For LOC105371841
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for knockout CRISPR/Cas9 clones, lentivirus, and/or AAV products for LOC105371841
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles, and/or promoter clone products for LOC105371841
- Search GeneCopoeia for miRNA 3'UTR Target clone products for LOC105371841
- Search GeneCopoeia for shRNA, lentivirus, and/or AAV clone products for LOC105371841
Sources for LOC105371841 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource