Aliases for LOC105371841 Gene

Subcategory (RNA class) for LOC105371841 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC105371841 Gene

  • Uncharacterized LOC105371841 3

External Ids for LOC105371841 Gene

Previous GeneCards Identifiers for LOC105371841 Gene

  • GC17U902165

Summaries for LOC105371841 Gene

GeneCards Summary for LOC105371841 Gene

LOC105371841 (Uncharacterized LOC105371841) is an RNA Gene, and is affiliated with the ncRNA class. Diseases associated with LOC105371841 include Joubert Syndrome 28 and Bardet-Biedl Syndrome 13.

Additional gene information for LOC105371841 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for LOC105371841 Gene

Genomics for LOC105371841 Gene

GeneHancer (GH) Regulatory Elements for LOC105371841 Gene

Promoters and enhancers for LOC105371841 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J058218 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 750.6 -0.6 -605 2 ZNF785 ZBTB40 CTCF RBPJ POLR2A ATF1 CREB1 HCFC1 MIXL1 RUNX1 MKS1 ENSG00000287337 LOC105371841 LPO HSALNG0117695 SRSF1 VEZF1 SKA2 SMG8 TEX14
GH17J058224 Enhancer 0.7 Ensembl 0.6 +4.6 4621 1.2 SMARCE1 TEAD4 SP7 ZSCAN21 SMARCA4 PKNOX1 CREB1 NFRKB JUN LEF1 SRSF1 MKS1 LOC105371841 ENSG00000287337 HSALNG0117695 LPO ENSG00000286788
GH17J058232 Enhancer 1 FANTOM5 ENCODE 0.4 +13.0 13001 1.7 SMARCE1 MYC ETV6 L3MBTL2 MAX POLR2A MLLT1 ZNF687 CREM EGR1 EPX SUPT4H1 LOC105371841 LPO HSALNG0117695 ENSG00000286788 ENSG00000287337
GH17J058238 Promoter 0.8 EPDnew Ensembl 0.4 +18.7 18721 0.2 CEBPG CEBPB LPO ENSG00000286788 LOC105371841
GH17J058244 Enhancer 0.7 Ensembl ENCODE 0.3 +26.1 26106 2.3 PRDM10 HDAC1 ZNF316 ZFP69B DPF2 CBFA2T3 ENSG00000286788 MKS1 HSALNG0117698 LPO LOC105371841
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105371841 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105371841 Gene

Genomic Locations for LOC105371841 Gene
chr17:58,219,980-58,233,553
(GRCh38/hg38)
Size:
13,574 bases
Orientation:
Plus strand

Genomic View for LOC105371841 Gene

Genes around LOC105371841 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105371841 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105371841 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105371841 Gene

Proteins for LOC105371841 Gene

Post-translational modifications for LOC105371841 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105371841 Gene

Domains & Families for LOC105371841 Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for LOC105371841 Gene

Function for LOC105371841 Gene

Phenotypes From GWAS Catalog for LOC105371841 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105371841 Gene

Localization for LOC105371841 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105371841 Gene

Pathways & Interactions for LOC105371841 Gene

PathCards logo

SuperPathways for LOC105371841 Gene

No Data Available

Gene Ontology (GO) - Biological Process for LOC105371841 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105371841 Gene

Drugs & Compounds for LOC105371841 Gene

No Compound Related Data Available

Transcripts for LOC105371841 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105371841 Gene

No ASD Table

Relevant External Links for LOC105371841 Gene

GeneLoc Exon Structure for
LOC105371841

No data available for mRNA/cDNA for LOC105371841 Gene

Expression for LOC105371841 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105371841 Gene

Orthologs for LOC105371841 Gene

No data available for Orthologs and Evolution for LOC105371841 Gene

Paralogs for LOC105371841 Gene

No data available for Paralogs for LOC105371841 Gene

Variants for LOC105371841 Gene

Sequence variations from dbSNP and Humsavar for LOC105371841 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1031187314 uncertain-significance, Joubert syndrome, Meckel-Gruber syndrome 58,219,167(+) G/A/T upstream_transcript_variant
rs116514023 benign, uncertain-significance, not specified, Meckel-Gruber syndrome, Bardet-Biedl syndrome 58,219,248(+) G/C upstream_transcript_variant
rs1244307754 uncertain-significance, Bardet-Biedl syndrome 13, Joubert syndrome 28, Meckel syndrome type 1 58,219,242(+) CGCGCCGCGACTGCGCCGGAAAGCGCGCCGC/CGCGCCGC upstream_transcript_variant
rs1311306088 uncertain-significance, Joubert syndrome, Meckel-Gruber syndrome 58,218,682(+) G/A/C upstream_transcript_variant
rs1555601787 likely-pathogenic, Bardet-Biedl syndrome 13, Joubert syndrome 28, Meckel syndrome type 1 58,219,230(+) T/C upstream_transcript_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105371841 Gene

Disorders for LOC105371841 Gene

MalaCards: The human disease database

(4) MalaCards diseases for LOC105371841 Gene - From: GeneCards

Disorder Aliases PubMed IDs
joubert syndrome 28
  • jbts28
bardet-biedl syndrome 13
  • bbs13
meckel syndrome, type 1
  • mks1
bardet-biedl syndrome
  • biedl-bardet syndrome
- elite association - COSMIC cancer census association via MalaCards
genes like me logo Genes that share disorders with LOC105371841: view

No data available for UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105371841 Gene

Publications for LOC105371841 Gene

No publications were found for LOC105371841 Gene.

No data available for External Links for LOC105371841 Gene

Products for LOC105371841 Gene

Sources for LOC105371841 Gene