LOC105371720 Gene (RNA Gene)

Uncharacterized LOC105371720

GC17P030236
GIFtS:
4

Aliases for LOC105371720 Gene

Subcategory (RNA class) for LOC105371720 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC105371720 Gene

  • Uncharacterized LOC105371720 3

External Ids for LOC105371720 Gene

Previous GeneCards Identifiers for LOC105371720 Gene

  • GC17U902295

Summaries for LOC105371720 Gene

GeneCards Summary for LOC105371720 Gene

LOC105371720 (Uncharacterized LOC105371720) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105371720 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for LOC105371720 Gene

Genomics for LOC105371720 Gene

GeneHancer (GH) Regulatory Elements for LOC105371720 Gene

Promoters and enhancers for LOC105371720 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH17J030235 Promoter/Enhancer 1.2 EPDnew Ensembl ENCODE 750.6 -1.2 -1205 1.4 L3MBTL2 ZNF121 ZNF687 PKNOX1 EZH2 RUNX3 GATA3 ZMYM3 LOC105371720 SLC6A4 ENSG00000264125
GH17J030237 Promoter 0.7 Ensembl 750.6 +0.3 295 0.4 CTCF RAD21 RXRB IRF2 RUNX3 TFDP1 GATAD1 MBD1 ENSG00000266120 LOC105371720 SLC6A4
GH17J030236 Enhancer 0.5 ENCODE 750.6 0.0 -39 0.2 CTCF RAD21 RXRB IRF2 RUNX3 TFDP1 GATAD1 MBD1 ENSG00000266120 LOC105371720 SLC6A4
GH17J030238 Enhancer 0.3 ENCODE 750.6 +1.9 1923 0.1 SAP130 ENSG00000266120 LOC105371720 RNU6-1267P BLMH ENSG00000252112
GH17J030244 Enhancer 0.8 FANTOM5 Ensembl ENCODE 0.4 +8.2 8199 0.7 EHMT2 POLR2A ZBTB17 FOS FOSL1 ENSG00000252112 BLMH LRRC37BP1 NSRP1 SSH2 CPD GOSR1 ENSG00000266120 LOC105371720
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105371720 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105371720 Gene

Genomic Locations for LOC105371720 Gene
chr17:30,236,906-30,252,233
(GRCh38/hg38)
Size:
15,328 bases
Orientation:
Plus strand

Genomic View for LOC105371720 Gene

Genes around LOC105371720 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105371720 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105371720 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for LOC105371720 Gene

Proteins for LOC105371720 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

Post-translational modifications for LOC105371720 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105371720 Gene

Domains & Families for LOC105371720 Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for LOC105371720 Gene

Function for LOC105371720 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105371720 Gene

Localization for LOC105371720 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105371720 Gene

Pathways & Interactions for LOC105371720 Gene

PathCards logo

SuperPathways for LOC105371720 Gene

No Data Available

Gene Ontology (GO) - Biological Process for LOC105371720 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105371720 Gene

Drugs & Compounds for LOC105371720 Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for LOC105371720 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105371720 Gene

No ASD Table

Relevant External Links for LOC105371720 Gene

GeneLoc Exon Structure for
LOC105371720

No data available for mRNA/cDNA for LOC105371720 Gene

Expression for LOC105371720 Gene

Products:

  1. Primer
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105371720 Gene

Orthologs for LOC105371720 Gene

No data available for Orthologs and Evolution for LOC105371720 Gene

Paralogs for LOC105371720 Gene

No data available for Paralogs for LOC105371720 Gene

Variants for LOC105371720 Gene

Sequence variations from dbSNP and Humsavar for LOC105371720 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs202111661 uncertain-significance, Behavior disorder 30,235,624(+) C/T upstream_transcript_variant
rs25533 likely-benign, Behavior disorder 30,235,874(+) A/G upstream_transcript_variant
rs34845320 uncertain-significance, Behavior disorder 30,235,699(+) C/T upstream_transcript_variant
rs774676466 pathogenic, Serotonin transporter activity, increased/decreased 30,237,267(+) GGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG/GGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG/GGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG intron_variant
rs886052782 uncertain-significance, Behavior disorder 30,235,740(+) T/C upstream_transcript_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105371720 Gene

Disorders for LOC105371720 Gene

No disorders were found for LOC105371720 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105371720 Gene

Publications for LOC105371720 Gene

No publications were found for LOC105371720 Gene.

No data available for External Links for LOC105371720 Gene

Products for LOC105371720 Gene

Sources for LOC105371720 Gene